1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dsp73
3 years ago
5

Which of these is a base? ammonia HCI vinegar HNO 3

Biology
1 answer:
Helen [10]3 years ago
6 0
Ammonia is a base.........
You might be interested in
Which organelle in the cardiac muscle cell stores calcium?
Westkost [7]
Sarcoplasmic reticulum
4 0
4 years ago
1. Which cells of the pancreas are the endocrine cells? How were you able to differentiate these cells when viewing the slide? D
Arturiano [62]

Answer:

Explanation:

Endocrine cells in the pancreas are referred to as Islets of Langerhan. There are two major types; Beta cell that produce insulin and alpha cells that produce glucagon.

They are identified when viewed under slides based on their colour reactions with histological dyes. Tinctorial techniques that can be used to identify them under microscope includes; Mallory-Heidenhain azan trichrome, chromium hematoxylin and phloxine, aldehyde fuchsin, and silver impregnation methods.

Islets of Langerhan cells make up minority of the cell. Majority of them are for exocrine functions.

8 0
3 years ago
What was Robert Brown looking at through a microscope when he found evidence of the 1827 scientific concept named in his honor?
Alexxx [7]
He was looking through a microscope at particles trapped in cavities inside pollen grains in water. The concept of Brownian motion is named after him. This is the random motion of particles suspended in a fluid, liquid or gas resulting from their collision with the fast-moving molecules. Here, the patterns of motion of the particles are typically alternations between random fluctuations in a particle's position inside a fluid sub-domain with a relocation to another sub-domain. Each relocation is followed by more fluctuations within the new closed volume. 
4 0
4 years ago
Read 2 more answers
When a species no longer exist it is said to be
Sedbober [7]
I think the answer is :extinct
4 0
3 years ago
The four nucleotides found in human DNA (G, A, T, C) combine in groups of three to create potentially 64 different amino acids,
Liula [17]

Question 1

Answer:

D- Different nucleotide combinations code for the same amino acid.

Explanation:

Some amino acid has more than one nucleotide combination coding for it.

Question 2

Answer:

B- Redundancy

Explanation:

Redundancy means that more than one codon is assigned for the coding of most amino acids.

Question 3

Answer:

0%

Explanation:

Since both parents are homozygous dominant and recessive respectively, no crossing can give the homozygous dominant as all offspring are heterozygous.                  

Question 4

Answer:

Homozygous.

Explanation:

The genotype 'dd' is homozygous since the two letters are both in the lower case.

Question 5

Answer:

25%                

Question 6

Answer:

Dihybrid cross

3 0
3 years ago
Other questions:
  • What happens to liver when you take drugs
    13·2 answers
  • What would be the effects of chronic infection or inflammation of the kidneys?
    9·1 answer
  • URGENTT!!!!!!!!!! What is the difference between plasma membrane and nuclear membrane?
    5·1 answer
  • 9. Who adds viruses into the petri dish to attack the cell?
    5·1 answer
  • Atoms are the most basic unit of matter. Two or more atoms from the same or different elements can combine to form molecules. Ce
    5·2 answers
  • Why do biologist have taxonomic systems
    14·1 answer
  • Curly hair (C) is dominant over straight hair(c). a heterozygous curly haired woman marries a homozygous straight haired man. wi
    7·2 answers
  • Can you answer all of these questions please
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which contains mostly hydrocarbons?<br><br> carbohydrates<br> proteins<br> salt<br> gasoline
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!