1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
9

During which process is mRNA converted into a sequence of amino acids for protein production?

Biology
1 answer:
dalvyx [7]3 years ago
9 0
Translation would be the answer to that question

You might be interested in
What are species survival plans meant to do?
Artist 52 [7]

Answer:

The Species Survival Plans are supposed to to help ensure the survival of selected species in zoos and aquariums, most of which are threatened or endangered in the wild.

Explanation:

I hope this helps you!

6 0
3 years ago
What question is most likely related to the field of biology
kupik [55]

Answer:

what is the average length of a cobra?

Explanation:

biology is the study of life.

7 0
3 years ago
PLS HELP ME
shepuryov [24]

Answer:

a 25%

Explanation:

the white flower is the heterogeneous offspring and there is only 1 white so 100÷4 =25

6 0
3 years ago
One of the reasons you might struggle to lift a heavy object with your arm fully extended is because:_______.
klasskru [66]

Answer:

the overlapping decreases between the thin and thick filaments.

Explanation:

When w extend our hand or arm to the full and try to lift any heavy object, we are unable to lift the object inspite of applying all our force. We struggle hard to lift the object with our fully extended arm because when we extend our arm fully it decreases the overlapping of our thin and the thick filaments of our muscles which makes it difficult to lift. In other words, the resting length of our arm is the optimal length to generate force.

4 0
2 years ago
Which is a device used to measure the energy
IRINA_888 [86]
Correct answer - C Energy Meter.

Why? - Energy meter are intended for energy measurements in three-phase electrical power network and can be used in residential, industrial and utility applications.
8 0
3 years ago
Other questions:
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Which type of preparations allows drug effects to continue at the same level over a long period?
    13·1 answer
  • An object in _____ emits radiation at the same rate it absorbs solar energy.
    14·1 answer
  • Why is the radiograph to the right NOT an acceptable parietoacanthial (Waters) projection?
    14·1 answer
  • Ramer wants to find out how pressure affects the force of gravity acting on dust particles in a cloud. Ramer designs an experime
    6·1 answer
  • What are the features of Nuclear Receptor Screening Services?
    5·1 answer
  • A scientist is trying to determine whether a newly observed phenomenon can be described as a wave. Which of the following questi
    9·1 answer
  • Which is an example of a nonfoliated metamorphic rock?<br> marble<br> granite<br> shale<br> slate
    6·1 answer
  • 3. Which of the following events involves a chemical change?
    6·2 answers
  • invertebrates and fish that eat dead organic matter will be most abundant in the of freshwater lakes.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!