1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vredina [299]
3 years ago
15

What electron carrier is used in the redox reactions in cellular respiration

Biology
2 answers:
antoniya [11.8K]3 years ago
6 0
<h2>Answer with Explanation </h2>

The electron that carries is use in redox reaction in the cellular respiration is a complex process. The electron carriers are needed to transport the electrons. The electron transfer that which is used during redox reaction in the cellular respiration is NAD+(NADH2). NADH is oxidized back to NAD+, and FADH2 is oxidized back to FAD. This stored energy can then be used to generate ATP. The ATP basic energy currency of a cell.

DaniilM [7]3 years ago
4 0

the correct answer is NAD+

hope this helps

You might be interested in
H-shaped area of the spinal cord is called _________ matter and it is located around the ________________ filled with cerebrospi
Anon25 [30]

Answer:

The correct answer is "grey; central canal".

Explanation:

Grey matter refers to an area of the brain, brainstem and cerebellum comprised of unmyelinated neurons and other cells that has given its name for having a pinkish-grey color in the living brain. Grey matter is also present in the spinal cord in an are of three grey columns that are H-shaped and it is located around the central canal filled with cerebrospinal fluid

7 0
3 years ago
A bird is observed to nest along the coastline. It then spends hours out in the open ocean feeding on fish. What is this behavio
3241004551 [841]

Answer:

Nesting & Foraging behavior

Explanation:

Seabirds are generally tertiary consumers and / or marine predators that, in marine foodwebs, occupy the upper trophic level. They are very well adapted to all marine ecosystems and feed on a variety of prey: from micro-crustaceans to fish and cephalopods.

Generally, seabirds are observed performing a nesting behavior, by laying eggs near the shore, and then are found exhibiting foraging behavior -searching and foraging for prey- in both the coastline and pelagic zone, also known as the open sea.

Seabirds exhibit different foraging behaviors, for example, the <u>surface feeding behavior which involves flying along the surface with their beak  in the water. Gulls, albatrosses and petrels are examples of surface feeders.</u>

<u>On the other hand, plunge diving involves preying on fast marine organisms by diving into the water during their flight. Pelicans are example of seabirds who engage in this behavior.</u>

8 0
3 years ago
What type of cells are Merkel cells?
abruzzese [7]

Answer:

Pressure sensing cells

Explanation:

Merkel cells provide information on pressure, position and deep static touch features such as shapes and edges. They are tactile sensors on the business of mechanotransduction. They encode surface features of touched objects into perception, but also have to do with proprioception.

7 0
3 years ago
If a person has a painful, bleeding injury to the nose, should aspirin be given to help? Why or why not?
sattari [20]

No, you should not give aspirin to a person if the have a painful, bleeding injury to the nose.  Because aspirin thins the blood and cause you to bleed that much more.  

3 0
3 years ago
Read 2 more answers
Please answer. I’ll give thanks to those who try and brainlyist to the one who gets the right answer
Nimfa-mama [501]

Answer:

Explanation:

B

7 0
3 years ago
Read 2 more answers
Other questions:
  • Explain the four steps of the calvin cycle
    15·1 answer
  • A scientist is determining the age of a rock by comparing their position to other rock layers. By doing this, the scientist is d
    12·1 answer
  • Why are newborn infants given a single injection of vitamin k?
    10·1 answer
  • Under which condition below would you expect a glassy extrusive rock like obsidian to form
    13·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The fact that a strain of yeast with a certain defective gene can use the human version of the gene to repair itself is evidence
    14·2 answers
  • Sort the following in the correct sequence for the flow of energy in a food chain. Start with the first organism on bottom.
    9·1 answer
  • A typical human cell has 90,000 insulin receptors. If a genetic error occurred,resulting in each liver cell in a person having o
    11·1 answer
  • An experiment was designed to investigate the effect of caffeine on the heartbeat of Daphnia magna, or water fleas. These tiny,
    12·1 answer
  • Genetic variation among humans is relatively small when compared to other species. Where in the human genome does most of the di
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!