1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivann1987 [24]
3 years ago
10

Which of the following describes cellular respiration?

Biology
2 answers:
marta [7]3 years ago
4 0
Cellular respiration would be:
b. glucose + oxygen --> carbon dioxide + water + ATP.
More specifically, the equation for cellular respiration is:
C6H1206 + 602 --> 6CO2 + 6H20 + ATP
Also, it may help you remember the equation by noticing that it is the exact opposite of photosynthesis :) Hope this helped!
GREYUIT [131]3 years ago
4 0

The cellular respiration is describes by:

\text{C}_6\text{H}_{12}\text{O}_2\rightarrow\text{6CO}_2+\text{H}_2\text{O}+\text{CHEMICAL ENERGY}+\text{ATP}

Further Explanation:

Cellular respiration or cell respiration happens in the living cells. In the cellular respiration process, animal utilizes oxygen and glucose to produce water and carbon dioxide. It is a metabolic process by which energy is produced in the form of ATP (adenosine triphosphate). It gives energy for the cell’s metabolic activity. It is a redox reaction wherein substrates like glucose molecules are oxidized and other molecules like oxygen are reduced. In anaerobic respiration, glucose is breakdown without oxygen. It mainly contains a sequence of biochemical reaction namely; glycolysis (the breakdown of glucose), citric acid cycle and electron transport chain. It is of two types:

  1. Aerobic respiration: This reaction is taking place when the body has an adequate amount of oxygen in the body.  
  2. Anaerobic respiration: This reaction occurs in the scarcity of oxygen. It does not entail oxygen to initiate the reaction. This reaction is independent of oxygen.

\text{C}_6\text{H}_{12}\text{O}_2\rightarrow\text{6CO}_2+\text{H}_2\text{O}+\text{CHEMICAL ENERGY}+\text{ATP}

Learn more:

  1. Learn more about carbohydrate monomer brainly.com/question/6947177
  2. Learn more about core muscle stabilization brainly.com/question/1231927
  3. Learn more about energy storagehttps://brainly.com/question/523624

Answer Details:

Grade: High School

Subject: Biology

Topic: Respiration

Keywords:

Cellular respiration, glycolysis, Krebs’s cycle, adequate, respiration, oxygen, citric acid cycle, electro transport chain, body, water, oxygen, carbon dioxide.

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
2 years ago
Why is ozone an important part of earth’s atmosphere ?
GREYUIT [131]
The ozone layer helps prevent harmful UV rays from entering the atmosphere.
4 0
3 years ago
Read 2 more answers
Identify the three main stages of translation. Check all that apply. elongation promotion termination initiation
irga5000 [103]

elongation

termination

initiation


5 0
3 years ago
Read 2 more answers
What is the impact of life skill to you? A. To be able to create problems B. To be self assertive. C. To be influenced by friend
PIT_PIT [208]

Answer:

To self assertive

Explanation:

Gives you confidence and advance on you're own personality and views.

6 0
2 years ago
Plant Nutrition and Photosynthesis ​
Ghella [55]

Answer:como

Explanation:

cmefr ut y aversduraos

3 0
2 years ago
Other questions:
  • Which of the following is most likely to cause increases in a predator population?
    8·1 answer
  • What property of water allows nutrients and gases to move throughout the body
    11·1 answer
  • Which type of wetlands are shrub-filled, watery, coastal, freshwater bogs? a. fens b. marshes c. pocosins d. riparians
    15·1 answer
  • Compared with people who do not have schizophrenia, synaptic pruning occurs __________ in people who do have the disorder.
    12·1 answer
  • Which molecule is shown a magenta (pink/purple)
    9·1 answer
  • A gene exists as two alleles in a population of freely mating individuals. if 40% of the population carries the recessive allele
    13·1 answer
  • Which describes a protein? A. Forms an important part of cell membranes. B. Provides the greatest amount of energy per gram. C.
    13·1 answer
  • The force that pulls falling objects toward earth is called
    14·1 answer
  • Proteins are chains of<br> O fatty acids<br> O glucose<br> O vitamins<br> O amino acids
    6·2 answers
  • Select the possible energy sources for muscle contraction from the list.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!