1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Romashka-Z-Leto [24]
3 years ago
5

True or False: Mollusks have a heart and a closed circulatory system

Biology
1 answer:
ycow [4]3 years ago
5 0
False. They have an open <span>circulatory system</span>
You might be interested in
PLEASE HELP WITH MY EARTH SPACE SCIENCE QUESTION
sashaice [31]
I think its b i hope am right 
3 0
3 years ago
How are mitochondria similar to chloroplasts? Both have many layers of membranes. Both contain molecules of chlorophyll. Both ar
lorasvet [3.4K]

Answer:

Both have many layers of membranes

Explanation:

4 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
49 POINTS!!!!!!!!!!!!!!!!!!!!!!
Akimi4 [234]

The porcupine is a rodent with an unusual trait. Porcupines have sharp spines or quills that help protect it against its predators. This trait is different from other rodents because of its needle like quills. This animal is also similar to that of a hedgehogs.

4 0
3 years ago
Read 2 more answers
In the event of an oil spill, why is it a
Firlakuza [10]

Answer:

The answer is D.

Explanation:

It wont sink down and it stays in one spot.

6 0
2 years ago
Read 2 more answers
Other questions:
  • When new individuals enter a population, genetic diverse increases or decreases?
    9·1 answer
  • Which system consists of the body’s outer covering?
    5·2 answers
  • Hurry please!!!
    7·2 answers
  • The inhibition of enzyme synthesis by the end product of a catabolic pathway occurs in the enzyme ____
    13·1 answer
  • Why bacteria in the soil. are necessary in this ecosystem 8th Grade Science
    14·2 answers
  • Explain where plants get their matter from?
    15·1 answer
  • Need help please ):
    9·2 answers
  • A 57-year-old man is evaluated in the clinic for a routine physical exam. He is followed for hypertension and hyperlipidemia. He
    10·1 answer
  • Question 11 (1 point) What prevents backflow of urine into the kidneys? O
    13·1 answer
  • What is used to power the ATP Synthase?<br><br> Glucose <br><br> Hydrogen ions <br><br> Water
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!