1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Evgen [1.6K]
3 years ago
9

How is it possible that over 20 million living organisms on the planet are made up of only 5types of nucleotide bases arranged i

n long chains
Biology
1 answer:
ycow [4]3 years ago
8 0

The nucleotide bases are adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). The bases combine with sugar to make them adenosine, guanosine, cytidine, thymidine, and uridine repectively.

The bases can be arranged in many different combinations and the genes in their long chains can have trillions of different combinations.

You might be interested in
Question 3 (5 points)
V125BC [204]
The answer is False okay?
7 0
3 years ago
1.What might happen to the Spotted and Barred Owls if humans don't interfere?
sammy [17]

Answer: If there is competition for food and nesting areas.

Explanation: Barred owls and spotted owls are well known as rivals. Barred owls are known to be aggressive towards spotted owls and are both bigger and more aggressive than them.

4 0
2 years ago
Read 2 more answers
A eukaryotic mutation upstream of a particular gene has been identified that changes the sequence of the TATA box to GATA. How w
Allushta [10]

Answer:

Transcription factor binding would be reduced or eliminated, and transcription of the gene would decrease dramatically.

Explanation:

Mutation means the changing of the structure of the gene that results in the variant form which may be transmitted to the subsequent generations.  They are caused by the altering the the single base units in the DNA of the species.

In both eukaryotic as well as prokaryotic, the mutation can affect the diversity in the future generation of the cells.

The eukaryotic mutation of the gene affects the transcription of the gene as the transcription factor binding will be lowered or will be eliminated and the transcription of this gene will decrease.

7 0
3 years ago
Can mold make u sick ​
mariarad [96]

Answer:

It depends on the mold.

Explanation:

Blue cheese, as well as all cheeses, are molds. These are safe to eat. However, eating moldy bread will make you sick, and while it is usually not fatal, it is best to consult a doctor. If you inhale black mold spores, it will grow in your lungs and eventually kill you.

6 0
3 years ago
Read 2 more answers
The presence of which of the following characteristics differentiates prokaryotic and eukaryotic cells?
ipn [44]

Answer:

The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not.

Prokaryotic Cell

Unicellular

Lysosomes and Peroxisomes absent

Microtubules absent

Endoplasmic reticulum absent

eukaryotic Cell

Multicellular

Lysosomes and Peroxisomes present

Microtubules present

Endoplasmic reticulum present

8 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A researcher sprays a new pesticide on thousands of insects of the same species that live in a large field. a few of the insects
    5·1 answer
  • plate tectonics can help explain which of the following a. ocean currents b. weather systems c.land errosion d. trenches
    12·2 answers
  • Typically, nitrogen atoms are composed of seven electrons, seven protons, and seven
    14·1 answer
  • Hi can someone tell me how fast a cheetah could go
    5·2 answers
  • This is science An organism that contains multiple cells is known is correctly known as a
    9·2 answers
  • Use the drop-down menu to complete the statement. One difference between prokaryotic cells and eukaryotic cells is that a eukary
    6·2 answers
  • Which relational dialectic is at work for the following scenario
    13·1 answer
  • Which of the following volcano hazards is made up of rocky particles about the size of a grain of sand?
    7·1 answer
  • A/an ____________________ is a benign fatty tumor under the skin that causes a bump.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!