1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
const2013 [10]
3 years ago
13

Do decomposers have predators?

Biology
1 answer:
Licemer1 [7]3 years ago
7 0
Yes, decomposers have predators. A worm is a decomposer, but it's predator is birds.
You might be interested in
In the 1960s, new evidence helped support the theory of continental drift and change it into the theory of plate tectonics. What
mrs_skeptik [129]
They found fossils and rocks that did not fit the climate they should have ben found in.
8 0
3 years ago
Read 2 more answers
Select the correct answer. Where does most of the world's population tend to settle? A. near mountain valleys B. wherever the he
lora16 [44]

Answer:

the correct would be d your welcome

3 0
3 years ago
Read 2 more answers
Which structure is located between the trachea and a bronchiole?
VARVARA [1.3K]

Answer:

pharnyx

Explanation:

8 0
3 years ago
Read 2 more answers
When might an organism rely on fermentation to produce the energy it needs?
devlian [24]
When there is not enough oxygen for cells to use cellular respiration<span />
6 0
3 years ago
Penicillium notatum is a mold that is the source of the antibiotic penicillin. Which is the reason for placing it in the phylum
mafiozo [28]
<span>Penicillium does not seem to have sexual phase</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which items are sources of water pollution or water pollutants?
    8·2 answers
  • The four major functions of hormones are _____.
    10·1 answer
  • What term refers to the possession of both masculine and feminine gender characteristics?
    9·1 answer
  • In an eight-cell embryo of an organism, the cells of the upper tier are aligned over the cells of the lower tier at a slight ang
    9·1 answer
  • Why can squirrels survive a cold winter but flowers cannot
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • The following are disadvantages of sexual reproduction
    12·1 answer
  • What tissue surrounds the entire muscle and forms tendons?
    11·1 answer
  • What are bonds formed between different bases
    11·1 answer
  • an animal can wound a tree by scratching away the bark. the tree can respond to the wound in many ways. the sap quickly covers t
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!