1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr-060686 [28]
3 years ago
7

DNA fingerprinting bands are also referred to as

Biology
2 answers:
Amiraneli [1.4K]3 years ago
4 0

Answer:

The correct answer would be option C.

Explanation:

Restriction Fragment Length Polymorphism or RFLP is a method of genetic investigation on the molecular level that permits individuals to be recognized based on distinctive patterns of restriction enzyme cleave in specific points of DNA.

The basic technique for the identification of RFLPs involves segmenting a sample of DNA with the help of a restriction enzyme. Restriction enzymes can selectively restrict a DNA molecule wherever specific, short sequence is recognized.

Hence, RFLPs are referred to as DNA fingerprinting bands.

Leni [432]3 years ago
3 0
I am no expert but I think the correct answer is C.

You might be interested in
A. Structure that organizes motion of chromosomes.
stealth61 [152]

Answer:

lol NO I MENA CENTROILE

Explanation:

3 0
3 years ago
Read 2 more answers
Which of the following best describes the relationship of solar UV radiation to the environment?
Blababa [14]
The last option is the most accurate
Hope this helps!
6 0
3 years ago
Read 2 more answers
Which of the following organisms would be able to survive for long periods of time with no food source? Select all that apply.
DerKrebs [107]

Answer:

tortoise

Explanation:

7 0
2 years ago
The rain forest floor
Paha777 [63]

D I think because the trees block out all the sun

6 0
3 years ago
Which of the following is NOT true of plants?
s2008m [1.1K]

Answer:

D

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Nephrons consist of a renal corpuscle and a renal tubule. the renal corpuscles are located in the ________ of the kidney.
    8·1 answer
  • What are parts of the cell theory
    10·2 answers
  • Mrs. Jones is exposed to high-energy solar radiation. She develops skin cancer as a result of a mutation in skin cells. A physic
    6·1 answer
  • Why are vacuoles in plant cells many times larger than vacuoles in animal cells
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the following is a relatively new disease?
    5·1 answer
  • How does the endocrine system differ from other systems in the body?
    12·1 answer
  • Psychometric scores for anxiety, depression, negative self, somatization, and hostility were combined into a single Global Sever
    13·1 answer
  • A Cotton shirt takes more time to dry as compared to a synthetic shirt. Why?<br><br>​
    5·1 answer
  • Convert 6.86kilometer into meter​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!