1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nutka1998 [239]
3 years ago
9

Skin, mucous, T cells, macrophages, fever, antibodies, bacteria, B cells.

Biology
2 answers:
aalyn [17]3 years ago
7 0
Antibodies is the correct answer because they form bonds
GarryVolchara [31]3 years ago
5 0
Antibodies !!!!!!!!!!!!
You might be interested in
In most of the body, the arteries carry oxygenated blood and the veins carry deoxygenated blood. The exception to this pattern i
lbvjy [14]
Because depending on weather or not there is oxygen in the blood the flow and speed will be different from the heart because its coming from the direct source
5 0
3 years ago
what can I use for the nucleus and cytoplasm of a 3D animal cell model? Note: This model has the contents inside a plastic resea
GarryVolchara [31]
Try using a rubber bouncy ball
3 0
3 years ago
Read 2 more answers
Opinions also help people make decisions. Opinions are __________. Taking facts and opinions into account halos maximize limited
lara31 [8.8K]

Answer:

I intentally had an incorrect answer the right answer is subjective in case anyone needs it not bias its subjective. Explanation:

5 0
2 years ago
Read 2 more answers
Resumen sobre el agua
Gnom [1K]

Answer:

water is what earth is mainly made of. our bodies are also mainly water.

6 0
3 years ago
Read 2 more answers
Glycolysis results in a net gain of ____ atp molecules.
il63 [147K]

Answer:

As glycolysis proceeds, energy is released, and the energy is used to make four molecules of ATP. As a result, there is a net gain of two ATP molecules during glycolysis.

Explanation:

two atp molecules

5 0
2 years ago
Other questions:
  • The data above represent the results of three different crosses involving the inheritance of a gene that determines whether a ce
    5·1 answer
  • Who was george mendel and what was his greatest contribution to genetics?
    9·1 answer
  • The properties of carbon make it the backbone of organic molecules which form living matter.
    10·2 answers
  • Consider this pathway: epinephrine → g protein-coupled receptor → g protein → adenylyl cyclase → camp. identify the second messe
    8·1 answer
  • A scientist observed a fungus and recorded what she saw:
    8·1 answer
  • What is the correct answer?
    6·1 answer
  • Which of these resources CANNOT be produced sustainably?
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Alex wants to know if a fossil he found was closely related to cats. some likely features of the fossil that can help him reach
    5·1 answer
  • students learned that the job of one organelle in a cell is to filter out cellular wastes, toxins, and excess water or nutrients
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!