Answer:
1. Nucleotides
2. Amino acids
3. Amino acids
4. Glucose
Explanation:
All the above substance described are biomolecules. They are all polymers i.e. complex molecule bond together in a long repeating chain, made up of simpler subunits called monomers. The monomers of the different biomolecules outlined above are:
1. The nucleic acids, DNA and RNA carry genetic information and are made up of many NUCELEOTIDES. A nuceleotide is a chemical combination of a five carbon sugar (pentose), phosphate group and nitrogenous base. These nucleotides are arranged sequentially to form nucleic acids (RNA and DNA).
2. Myoglobin is a protein that binds oxygen molecules and is a polymer of AMINO ACIDS. Amino acids are the building blocks of proteins. They are arranged to form a 3D structure that determines the function of the protein.
3. Insulin is a protein hormone that regulates blood glucose levels and is a polymer of AMINO ACIDS. All proteins are made up of the amino acid but the protein's function is dependent on the 3D structure formed by the amino acid sequence.
4. Animals store energy in the form of glycogen, a carbohydrate made up of thousands of monosaccharide (GLUCOSE). Glycogen is a polysaccharide made up of many monosaccharide units. These units are glucose molecules that are multibranched to form the glycogen that stores mainly in the liver and muscles of animals.
Answer:
CAGUAGCUGCUAGCCUACGG
Explanation:
A and U are opposites
C and G are opposites
so you would do the opposite that would correspond.
If you are asking if that is true or false I'd say true.
Hope this helps... mark as Brainliest plz
An integral membrane protein is a kind of membrane protein, which is perpetually combined with the biological membrane. All transmembrane proteins are integral membrane proteins, but not all integral membrane protein are transmembrane proteins.
These proteins are anchored in the lipid bilayers and only non-polar, hydrophobic amino acid residues would be found in the part of the protein, which crosses the membrane. In the interior of the bilayer, these residues would be hidden from the water solvent and associate with the non-polar lipid tails.
That would be biochemistry.
