1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rainbow [258]
3 years ago
14

Which of the following occurs when organisms interact with other living things and their inviroment?

Biology
1 answer:
malfutka [58]3 years ago
7 0
The answer is Ecology.
You might be interested in
This is for today help me pls!!
pashok25 [27]

Answer:

I do not see the picture

Explanation:

4 0
2 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
The RNA that is translated into a polypeptide is ______ RNA
kkurt [141]

Answer:

The RNA that is translated into a polypeptide is <u>messenger</u> RNA

Explanation:

Brainliest please! :)

7 0
3 years ago
________ is the backup energy molecule that can be rapidly converted to ATP in active skeletal muscle.
umka2103 [35]

Hai :3

What is the backup energy molecule that can be rapidly converted to ATP in active skeletal muscle?

The answer would be D. Phosphocreatine, because phosphocreatine plays a major role on energetic homeostasis in both active skeletal and cardiac muscles. Phosphocreatine is basically creatine but phosphorylated, and that is why it has such a name. It has the role of turning ADP (adenosine diphosphate) into ATP (adenosine triphosphate).

Remember, ATP is the currency of life! That is what my biology teacher taught me.

7 0
3 years ago
Which of the following suggests that humans have reached our carrying capacity? Humans are unable to increase food production to
Svet_ta [14]

Answer:

The human population is yet to reach its carrying capacity. However, the following will suggest that humans have reached their carrying capacity.

1. When humans are unable to increase food production which is expected to sustain a larger population.

2. When humans' use of resources, in general, is greater than resource availability.

Explanation:

The human population is yet to reach its carrying capacity. However, the following will suggest that humans have reached their carrying capacity.

1. When humans are unable to increase food production which is expected to sustain a larger population.

2. When humans' use of resources, in general, is greater than resource availability.

4 0
3 years ago
Other questions:
  • ​fertility usually resumes within _____ after contraceptive use stops.
    10·1 answer
  • What’s is the substance that chromosomes are made from?
    5·2 answers
  • What substance is the USABLE source of the energy that an animal cell uses for the synthesis of materials?
    14·1 answer
  • Which recording station is farthest from the epicenter
    6·1 answer
  • The denser a liquid, the slower it flows. The table below shows the mass and volume of two different liquids
    14·1 answer
  • What component of volcanic eruptions can block sunlight over large areas?
    12·1 answer
  • What is an aquifer?
    5·1 answer
  • Chandra X-ray observatory has reported that they have found a new star near our solar system. The Chandra X-ray telescope detect
    6·1 answer
  • This is the gas produced as a product of photosynthesis
    13·1 answer
  • Humans are responsible for some of the negative changes that occur in nature because they
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!