1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-BARSIC- [3]
3 years ago
8

2.   A series circuit contains two devices, one with a resistance of 10 ohms and one with a resistance of 4 ohms. If the generat

or supplies a voltage of 42 V, what is the magnitude of the current?
    
  A. 3 A
  B. 1.75 A
  C. 2 A
  D. 1.33 A
3. When all parts of a circuit are composed of conducting materials, the circuit is said to be
    
  A. parallel.
  B. closed.
  C. open.
  D. shorted
4. Suppose you have two magnets. Magnet A doesn't have its poles labeled, but Magnet B does have a clearly labeled north and south pole. If these two are brought into contact with one another, which of the following could you expect?
    
  A. The side of Magnet A that's repelled by Magnet B's north pole must be Magnet A's south pole.
  B. The side of Magnet A that's attracted to Magnet B's south pole must be Magnet A's north pole.
  C. The side of Magnet A that's repelled by Magnet B's south pole must be Magnet A's north pole.
  D. The side of Magnet A that's attracted to Magnet B's north pole must be Magnet A's north pole
Biology
2 answers:
dsp733 years ago
7 0
2. In series, we add the resistance up
Use the formula V = IR to find the current.
R = 10+4 = 14, V=42
42=I (14)
I = 42/14 = 3 A

3. Closed

4. Answer B
This is because unlike poles attract and like poles repel.

Hope it helped!
mafiozo [28]3 years ago
3 0

answer is 1.75a for the question


You might be interested in
Temperature is a way to measure the ___________ energy of particles of matter.
Fed [463]

Answer:

Kinetic

Explanation:

The average kinetic energy of the particles in a material is measured by temperature. The overall kinetic energy of the particles in a material is measured by thermal energy. The higher the particle mobility, the higher the temperature and thermal energy of a material.

3 0
2 years ago
Stand and let your hands hang next to your sides for a few minutes. Then, look at the backs of your hands. Do you see any bumps
blagie [28]

Answer:

no bumps that i can see

Explanation:

7 0
2 years ago
What roles do electrons and hydrogen ions play in the
Lisa [10]

Answer:

Explanation:

have a good day but ion know the answer..

8 0
3 years ago
Which of the following most directly explains the changes in the cells?
Harlamova29_29 [7]

C. The movement of water from the central vacuoles of cells into the solution

3 0
3 years ago
How do a chromosome, a gene, and an allele differ? How are they similar?
umka2103 [35]

Answer: A gene is a sequence of nucleotides in DNA or RNA that encodes the synthesis of a gene product, either RNA or protein. A chromosome is a long DNA molecule with part or all of the genetic material of an organism. A allele is one of two or more alternative forms of a gene that arise by mutation and are found at the same place on a chromosome.

Explanation:

8 0
3 years ago
Other questions:
  • What is salivary gland? tell its functions.
    13·2 answers
  • In the central african republic and cameroon tsetse flies cause the spread of
    7·1 answer
  • One company states that it makes the best staplers. To prove it, they use the stapler to staple a thousand papers and compare it
    5·2 answers
  • 3. deference between diffusion and osmosis​
    10·1 answer
  • After the drought of 1977, researchers hypothesized that on the Galápagos island Daphne Major, medium ground finches with large,
    10·1 answer
  • What is goose flesh​
    12·1 answer
  • Please HURRY!!
    15·1 answer
  • Which plant would have an advantage in getting pollinated?
    7·1 answer
  • Theory is an idea in science true or false
    14·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!