1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
3 years ago
14

Where is chemical energy contained in a compound

Biology
2 answers:
lawyer [7]3 years ago
3 0
Isn't it in the bonds?
rusak2 [61]3 years ago
3 0

Answer: Bonds.

Explanation:

The energy of the compounds lies in the bonds present in the compound. Energy is released from the compounds when the bonds are broken.

Example: Adenosine triphosphte is hydrolyzed and adenosine diphosphate and inorganic phosphate is produced. This process releases energy by the breakdown of bonds which is used for carrying various metabolic processes of the body.

Hence, the chemical energy is stored in the bods of the compounds.

You might be interested in
Fossil steroid and molecular clock evidence suggests that animals originated __________.
andreev551 [17]

Answer:

Fossil steroid and molecular clock evidence suggests that animals originated between 770 and 710 million years ago

Explanation:

4 0
2 years ago
95 points URGENT WILL GIVE BRAINLIEST PLEASE HELP FAST
Anna007 [38]

Hey you yes you, I have the answer you need!

The brain sends messages via the spinal cord to peripheral nerves throughout the body that serve to control the muscles and internal organs. The somatic nervous system is made up of neurons connecting the CNS with the parts of the body that interact with the outside world.

Hope this helps!!

5 0
3 years ago
Read 2 more answers
Mention three importance of soil organisms.​
rusak2 [61]

Explanation:

soil organisms which range in size from microscopic cells that digest decaying organic material to small mammals that live primarily on other soil organisms play an important role in maintaining fertility structure drainage and aeration of soil

7 0
3 years ago
why are the polio virus unable to reproduce if their DNA base sequence is different from the normal virus?
maks197457 [2]

Answer:

When the virus infects a cell, the RNA genome enters the cell and programs it to make new virus particles. These virus particles are released from the cell and go on to infect new cells. In humans, poliovirus is ingested, and replicates in cells of the gastrointestinal tract.Poliovirus, the prototypical picornavirus and causative agent of poliomyelitis, is a nonenveloped virus with a single-stranded RNA genome of positive polarity. The virion consists of an icosahedral protein shell, composed of four capsid proteins (VP1, VP2, VP3, and VP4), which encapsidates the RNA genome (1).RNA viruses generally have very high mutation rates compared to DNA viruses, because viral RNA polymerases lack the proofreading ability of DNA polymerases. The genetic diversity of RNA viruses is one reason why it is difficult to make effective vaccines against them.

5 0
2 years ago
What happens to the breathing rate of an individual when working out?
pogonyaev

Answer:it increases!

Explanation:

6 0
2 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A woman has two dominant alleles. What is her phenotype?
    11·2 answers
  • Guiding Question: What environmental factors are needed to sustain life on another planet? Claim: (make a statement about activi
    6·2 answers
  • How does the central vacuole of a plant cell allow the plant to stand up right wilt?
    10·1 answer
  • During what reproduction, cells reproduce identical and unidentical offspring
    7·1 answer
  • The table shows the rate of melanoma by gender. mc026-1.jpg Consider the number of males who were diagnosed with melanoma in 200
    7·2 answers
  • what are the three structural changes that must occur in young, unmodified plant cells as they specialize into xylem tissue
    6·1 answer
  • What is the function of cell selectivity Permeable plasma membrane
    11·1 answer
  • Is diffusion the only way materials can enter the cell?
    14·1 answer
  • When two monomers come together to make a polymer, a molecule of what is released? a.NO2 b.CO2 c.H2O d.H2O2
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!