1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
3 years ago
5

The evolutionary theory that suggests that a species can suddenly and rapidly evolve into a new species is

Biology
2 answers:
mr_godi [17]3 years ago
8 0
C. punctuated equilibrium. Scientists believe in two evolutionary theories: gradualism and punctuated equilibrium. If punctuated equilibrium suggests species can rapidly evolve into a new species, gradualism suggests that these changes (selection and variation) happen more gradually.
Gnom [1K]3 years ago
6 0

Answer:

C. punctuated equilibrium

Explanation:

  • The evolutionary theory of punctuated equilibrium was proposed in the year by 1972 by  Stephen Jay Gould.
  • According to this theory in the evolution of species, there are two types of periods that occur - one is the stasis and the other is punctuation.
  • During punctuation, the individuals show sudden and rapid change and evolve into new species whereas in the static period they remain as it is without changing themselves.
You might be interested in
A waxy secretion produced by glands in the ear canal is:
krek1111 [17]
The waxy secretion is earwax
6 0
3 years ago
Explain an example why selective breeding is an example of biotechnology
lina2011 [118]
Example of selective breeding: Cows that produce lots of milk. Selective breeding to create more useful varieties of animals and plants is a form of biotechnology that human beings have used for thousands of years. Biotechnology includes any use of science or technology to alter the characteristics of a particular breed or animal.
7 0
3 years ago
Where does the rock cycle start and stop? Explain why.
vlabodo [156]

Answer:

The cycle has no beginning and no end. Rocks deep within the Earth are right now becoming other types of rocks. Rocks at the surface are lying in place before they are next exposed to a process that will change them.

Explanation:

There is no beginning or end to the rock cycle, since all rocks on Earth can be influenced by the cycle and develop into new types.

5 0
4 years ago
An example of parallel choices in a key is _____.
Anna35 [415]
Flower color is red; AA. flower color is blue
3 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Other questions:
  • What variable stars have pulsation periods between 1.5 hours and 1.2 days?
    5·1 answer
  • These are organism that come from the same cell and are genetically identical to one another
    10·2 answers
  • Because she is so active, cardiovascular fitness is important to Vicky. She learns that hemoglobin is an important globular prot
    14·2 answers
  • Somatic cells of chimpanzees contain 48 chromosomes. how many chromatids and chromosomes are present at (a) anaphase of mitosis,
    10·1 answer
  • Scientists now know how much carbon dioxide was present in the atmosphere as far back as 800,000 years ago. How did they obtain
    11·2 answers
  • The healing of a wound in a human is most similar to the process of
    13·1 answer
  • consider a husband and wife who are both heterozygous for the autosomal recessive allel that causes albinism and who are both bl
    9·1 answer
  • Which chemical weathering process involves the action of carbonic acid
    9·1 answer
  • How do organisms use carbon-based molecules and make water
    14·1 answer
  • Which of these elements is likely to be found in an organic compound?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!