1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ale4655 [162]
3 years ago
7

Which traits are challenges of life for all organisms? Choose all answers that are correct. A. reproducing B. getting sunlight C

. hiding or running D. maintaining structure E. swimming upstream F. obtaining energy G. laying eggs
Biology
1 answer:
RUDIKE [14]3 years ago
3 0
<span><span>a.   </span>Reproducing</span>
f. obtaining energy
d. maintaining structure

Why do these three illustrate the great challenge for every species. <span><span>
1.   </span>Reproduction, is as vital for an entire race to survive. It prolongs their generation onwards and offspring to the next centuries to pass by.</span> <span><span>
2.   </span>Obtaining energy. In both humans and animals, even plants is a challenge because these creatures need to work in order to obtain these need resource from food –preys.</span> <span><span>
3.   </span><span>Maintaining structure. For the living organisms to still exist they need to keep themselves intact. Combating diseases and having nutrition. This is a by-product of having energy.  </span></span>



You might be interested in
In the condition ________, a virus infects posterior root ganglia, causing a painful rash whose distribution corresponds to that
Tatiana [17]

Answer:

D) Shingles

Explanation:

Shingles(herpes zoster) is a viral infection of a nerve and its surrounding skin. The causative organism is the varicella-zoster virus.

Its symptoms include fever, general weakness, pain, hot sensation, rash begins to occur with red blotchy patches on one side of the skin.

3 0
3 years ago
#14 &amp; #15<br> Multiple choice
natka813 [3]
14 should be B if I can remember correctly, 15 is C
5 0
3 years ago
I WILL GIVE BRAINLY EST
ANEK [815]
Mechanical energy to chemical energy, i believe
6 0
3 years ago
Why do metals dissolve in acids?
Pepsi [2]

Answer:

In water or acids, the metals trade places with hydrogen. The hydrogen escapes as a gas, and metal atoms, no longer attached to the object from which they came, dissolve in solution.

sorry if I'm wrong but I wrote this in my hw and it was right so ye

8 0
2 years ago
Read 2 more answers
What are some risk factors for cancer (list at least 5)?
Snezhnost [94]

Answer: Older age.

A personal or family history of cancer.

Using tobacco.

Obesity.

Alcohol.

Some types of viral infections, such as human papillomavirus (HPV)

Specific chemicals.

Exposure to radiation, including ultraviolet radiation from the sun.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • This type of exocrine gland is a simple, branched acinar gland connected to a hair follicle.
    5·1 answer
  • Stem cell and cancer question. Please answer Asap!!
    10·1 answer
  • I will give brainliest please help
    6·1 answer
  • PLEASE IM BEGGIN YOU CAN YOU HELP
    10·2 answers
  • Describe some of destructive action of microbes ​
    13·2 answers
  • HELP!!
    14·1 answer
  • 4. What is the basic form of stored energy in fossil fuels?
    12·1 answer
  • Dbcig[asu9pvhbajibxuycbdsahibihbvibdilhfbailhbeuibfkjdsnofna;jsbrigbishdbfjdsa fhbdsbljbda;bfkjsadbfkjbdsk;jfbdkjbfk;ajbkhbfjheb
    5·1 answer
  • This is released by the weathering of rocks.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!