1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stells [14]
4 years ago
13

The restriction enzymes that cut the bacteriophage DNA cannot cut the bacterial chromosomal DNA. Explain this statement. The bac

teria can cut the viral DNA at its specific restriction site, but they cannot cut their own DNA since bacterial chromosomal DNA has altogether a different DNA sequence than the viral DNA. The bacteria can cut the viral DNA at its specific restriction site but protect their own chromosomal DNA by modifying its bases and blocking the restriction enzyme. The bacteria can cut the viral DNA at its specific restriction site but protect their own chromosomal D
Biology
2 answers:
Crazy boy [7]4 years ago
7 0
"<span>The bacteria can cut the viral DNA at its specific restriction site but protect their own chromosomal DNA by modifying its bases and blocking the restriction enzyme" is the one explanation to the statement given in question. The correct option among all the options that are given in the question is the second option.</span>
Leya [2.2K]4 years ago
5 0

The correct answer is option (B)  The bacteria can cut the viral DNA at its specific restriction site but protect their own chromosomal DNA by modifying its bases and blocking the restriction enzyme.

Restriction enzymes cleave the double stranded DNA at specific points into fragments. Endonucleases cleave the internal or the non-terminal phosphodiester bonds after recognizing specific sequences on the DNA which are often palindromic. To prevent the destruction of its own DNA by the restriction enzymes, a few specific bases are modified in each strand by the addition of the methyl groups. Bacteria prevent their own DNA from being cut by the restriction enzyme through the methylation of the restriction sites. The process is called the restriction modification system found in the bacteria and other prokaryotic organisms.  

You might be interested in
What group of protein regulates cell division in eukaryotes
meriva
The answer is mitosis.
5 0
3 years ago
7th grade Complete the following analogy:
meriva

Answer:

B

Explanation:

4 0
4 years ago
in yeast cells , the process that occurs when there is not enough oxygen for aerobic respiration is called
zalisa [80]
I believe it is anaerobic respiration
4 0
3 years ago
Read 2 more answers
What is true about the relationship between cells and the organism they are part of?
Viefleur [7K]

Cells make up the basic structure of an organism, and they perform basic life functions for the organism.

^the first one

7 0
3 years ago
Use Darwin's theory of Natural Selection to explain the process by which the four-legged land animal, A, may have evolved, over
Len [333]

Answer:

Due to environmental conditions.

Explanation:

With the passage of time, environmental conditions change which causes the evolution of of four legged land animals from fish like creature. This change occurs due to change in environment. In water, there is no need for legs because fish moves with the help of fins and tail but the organisms that lives on land has legs in order to move from one place to another so we can say that change in the physical structure of organism occurs due to environment.

5 0
3 years ago
Other questions:
  • People who exercise regularly can reduce their risk of osteoporosis. megaloblastic anemia. hemosiderosis. all of these are corre
    15·1 answer
  • Ancient civilizations generally associated illness with ____.
    10·1 answer
  • If you wanted to study the diversity of organisms at all levels of biological organization what Would You Study
    11·2 answers
  • Pls help me answer this question and pls put an explanation!!!!
    12·1 answer
  • Non-segmentation allows for evolutionary innovation in body form.<br>a. True<br>b. False​
    5·2 answers
  • What term is defined as muscle activity that burns calories?
    11·1 answer
  • Distinguish between sexual and sexual reproduction.Give an example of each.​
    15·2 answers
  • What happens to the structure of the kit receptor protein
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which field seeks to discover the influence of environment and heredity on individual differences in human development?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!