1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pani-rosa [81]
3 years ago
10

Unlike DNA, RNA A. contains nitrogenous bases. B. pairs uracil with adenosine instead of thymine. C. has deoxyribose as the suga

r within its nucleotide components. D. contains two strands wrapped in a helix.
Biology
1 answer:
labwork [276]3 years ago
8 0

pairs uracil with adenosine

You might be interested in
What is the range for the following set of Measurements 27C, 12C, 31C, 19C, 23C, 11C, 17C
aliya0001 [1]
31c-11c=20c So, therefore, the range is 20c.
Hope this helps! :D
5 0
3 years ago
Read 2 more answers
The atom has an incomplete valence shell <br><br> true or false
Tema [17]

Answer:

False

Explanation:

Thats a fact you can thank me later

6 0
3 years ago
Read 2 more answers
I just need the right words for each place. (8-10)​
uysha [10]
8. Glucose
9. NADH
10. 2 Pyruvic Acid
8 0
3 years ago
Which of the definitions below best defines a mutation?
victus00 [196]

The correct answer is: A. A change in a cell's genetic material.

Mutations occur in DNA as a result of mistakes during the DNA replication (when repair mechanisms don’t fix it) or as the result of environmental factors (e.g. UV light). Mutations can have positive impact, by increasing the genetic variation or can have negative effect, causing the diseases or cancer.

8 0
3 years ago
When meiosis is complete, what has been produced?
seropon [69]

Answer:

D. four haploid cells

Explanation:

When meiosis is complete,four haploid cells are formed from a single diploid cell. The four daughter cells produced that contains half the number of chromosome than that of their parent cell. Due to meiosis the number of chromosomes remain fixed in a species from generation to generation.

The process results in four daughter cells that are haploid, which means they contain half the number of chromosomes of the diploid parent cell. Meiosis has both similarities to and differences from mitosis, which is a cell division process in which a parent cell produces two identical daughter cells.

8 0
3 years ago
Read 2 more answers
Other questions:
  • An object travels to the east for 36.4m and then heads north for 21.0 meters, how far is the
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why is a smaller volume of the cell better?
    13·1 answer
  • Which resource is nonrenewable?
    10·2 answers
  • 6. Before transferring sperm to the female during mating, the males of some species of beetles use their copulatory organs to re
    15·1 answer
  • Name and define the two main kinds of reproduction
    10·1 answer
  • In a sample of double-stranded DNA, 30% of the nitrogenous bases are adenine (A).
    15·1 answer
  • After the transfer of electrons, calcium becomes an ion with a charge of Fill in the blank text field 5
    14·1 answer
  • Which of the following best describes how amino acids affect the tertiary structure of a protein?
    15·1 answer
  • Which of these is evidence of global warming?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!