1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
son4ous [18]
2 years ago
15

The physical characteristics of an organism that result from its genes are referred to as its

Biology
1 answer:
spin [16.1K]2 years ago
8 0
The correct answer is phenotype.
You might be interested in
why is it important that a cell membrane contains opening into the cell a the opening allows chemical such as oxygen and other n
wolverine [178]

Answer:

Explanation:

Cells generate energy from the controlled breakdown of food molecules. ... View Terms of Use  molecules that other cells rely on for the energy required to sustain growth, metabolism, ... proteins that span the cell membrane permit specific molecules into the cell, Figure 2: Cells can incorporate nutrients by phagocytosis.

4 0
3 years ago
Describe how scientists and biologists study the world
son4ous [18]

by experimenting the layers of the earth

4 0
3 years ago
Read 2 more answers
The deep posterior extensor of the wrist and fingers __________.
lions [1.4K]
Controls the thumb and index finger
5 0
2 years ago
Select all of the following functions that you think a plant would need to carry out in order to survive.
Gnoma [55]
Grow, reproduce, take in nutrients from the environment, respond to the environment, transport materials thru-out their body, produce chemicals
8 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Which species seem the least alike?
    12·1 answer
  • When a label says that a food has 20 amino acids what are they really trying to say?
    13·1 answer
  • Which statement is true about DNA?
    11·1 answer
  • What is the term for the non-living parts of a community?
    8·2 answers
  • Alonzo graduates with a 3.8 GPA in Accounting from a New York university and receives offers of employment from three of the Big
    7·1 answer
  • State two advantages of using a electron microscope rather than a light microscope
    6·1 answer
  • (GIVING BRAINLIEST!!)
    7·1 answer
  • Which of the following statements about daughter cells are true? (Select all that apply.)
    9·1 answer
  • Select all that apply. Which of the following are characteristics of eukaryotes? membrane-bound organelles cell(s) larger than p
    10·1 answer
  • Which of the following are outcomes of refrigeration?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!