1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yanka [14]
3 years ago
7

The picture below represents an oxygen atom. How many protons does this atom have?

Biology
1 answer:
dezoksy [38]3 years ago
8 0
First answer: A : 8 protons







Hope this answers your question
You might be interested in
Which of these bests explains the difference between the way animals and plants exchange gases with their environments?
Marizza181 [45]
Answer: Animals use only respiration, while plants use both photosynthesis and respiration.
6 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
When the brain is unoccupied, an fmri indicates that blood continues to flow via a web of brain regions called the?
bulgar [2K]

Default network


When the brain is unoccupied, an fMRI indicates that blood continues to flow via a web of brain regions called the default network.

The default network is a web of brain regions that have activity that corresponds greatly with each other and different from other networks within the brain. The default network is active when an individual's attention is not concentrated on the external environment and it is measured with the functional magnetic resonance imaging technique (fMRI).



7 0
2 years ago
_____ (meaning ''spiny skin'') have a water vascular system that functions in locomotion, feeding, and gas exchange.
n200080 [17]

The answer is:

Echinodermata

The word echinodermata is Greek which literally means "Spiny Skin". Echinodermata is a phylum under kingdom animalia. Not all of them have spiny skins, but most of them do. Other characteristics would be their radially symmetric body. They have appendages that grow outward from the center. Examples of echinoderms would be sea stars and sea urchins.

4 0
2 years ago
While traveling through the rain forests of Peru, you are introduced to a rare and exotic plant. You discover that it contains a
Marianna [84]

Answer:

A. Oedema and ion imbalance

Explanation:

The proximal tubule is very important to the maintenance of homeostasis in the renal microenvironment. The alterations of the physiological functions will therefore distort the reabsorption of other ions. The blockage of sodium reabsorption into the channel will leads to an hypotonic internal environment. This will afterward leads to reduction of the reabsorption of water into the organ and increase the reabsorption of other ions into it. This will have clinical effect on the organism. Which is oedema of the extracellular surrounding of the tubules through accumulation of fluids and could lead to imbalance in neurological sense due to the imbalance in other ions.

3 0
3 years ago
Other questions:
  • What is a silurus glanis fish and what does it look like?
    14·1 answer
  • Thomas's biological mother and father are both gifted athletes. He was adopted by a couple who had no interest in him being invo
    11·1 answer
  • Which scientist developed the system for classifying organisms
    12·2 answers
  • Which is the most efficient way to avoid DNA mutations from UV radiation?
    10·2 answers
  • A pyramid of energy can be used to illustrate the loss of usable energy at each feeding level in a food web. In which feeding le
    10·2 answers
  • Macrophage cells undergo a process called phagocytosis in which material is brought into a cell in the form of membrane vesicles
    11·1 answer
  • Which of the following structures collects the depolarization wave from the atria to pass it onto the ventricles?
    5·1 answer
  • What is the cell membrane made up of?
    12·2 answers
  • Which of the following activities below shows a heterogeneous mixture? *
    10·1 answer
  • Many foods—for example, bacon and salt cod—are preserved with high concentrations of salt. How can high concentrations of salt i
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!