1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
9

What is the significance of chitin in arthropods?

Biology
1 answer:
spin [16.1K]3 years ago
6 0
Chitin is a structural carbohydrate that forms their exoskeleton.
You might be interested in
Remoras are fish that attach themselves to sharks. They travel with the shark and eat leftover shark food. This neither harms no
g100num [7]

Answer:

B) commensalism

Explanation:

The symbiotic relationship between Remoras and sharks is a commensalism relationship where the the shark neither benefit nor loss from such relationship

Commensalism relationship is a relationship in which the one of the living organism benefits from associating with another organism (host organism). The commensal organism benefits such things as locomotion, food, shelter etc.

The host organism neither benefit nor get harmed

From the question, Remoras are the commensal organism while sharks are the host organism

3 0
3 years ago
Which of the following biological molecules
yarga [219]

Answer:

protein

Explanation:

because carbohydrate ..nucleic acids protein

3 0
3 years ago
True or false: Due to starvation, amino acids from muscle tissue are converted into glucose. This wastes muscle tissue and can l
Zanzabum

Answer:

True

Explanation:

Because all the amino acids in the tissue muscle are converted tp glucose so u could have energy to live

3 0
2 years ago
How did the Rf values differ between pigments and solvents?
lara31 [8.8K]

Answer:

The Rf values indicate how soluble the particular pigment is in the solvent by how high the pigment moves on the paper.

Explanation:

The Rf values indicate how soluble the particular pigment is in the solvent by how high the pigment moves on the paper. Small Rf values tend to indicate larger, less soluble pigments while the highly soluble pigments have an Rf value near to one.

7 0
3 years ago
PLEASE HELP WITH MY BIOLOGY
Alecsey [184]

I think A makes the most sense..

6 0
3 years ago
Other questions:
  • The nurse is required to administer vitamin k to a term newborn. how should the nurse administer this injection
    13·1 answer
  • Regions of the sea floor with positive magnetic anomalies were found during times when earths magnetic field ______. (PLZ Help m
    10·1 answer
  • What is 15ml to the nearest 0.1 ml
    13·2 answers
  • Who called people who cared for animals "veterinarius"?
    11·2 answers
  • What kinds of substances cause the destruction of ozone?
    14·2 answers
  • The molecule pictured below produced a blue color when tested with Benedict’s reagent, a yellow color when tested with IKI, and
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The binding of Ach to its muscuranic receptors indirectly affects the permeability of _____ channels which can produce hyperpola
    7·1 answer
  • Why does the trait for shortness seem to “skip a generation”?
    5·1 answer
  • Somebody help me so I can give y’all some points
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!