1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Troyanec [42]
3 years ago
5

Maxwell needs to take an anti-depressant drug. he enrolls in a clinical trial to detect genetic variants and gene expression pro

files associated with response to various drugs. this approach to selecting a therapeutic drug is called:
Biology
2 answers:
anastassius [24]3 years ago
7 0

Pharmacogenomics

Pharmacogenomics is the study of how an individual’s genetic make can affect his response to a drug. Pharmacogenomic information such as selecting a drug that is more likely to work, adjusting the dose of a drug, and avoiding drugs that might have side effects helps health care providers to choose the most suitable treatment for each patient.







nadezda [96]3 years ago
3 0
<span>Answer: pharmacogenomics

</span><span>Pharmacogenomics is the field that studies how the drug effect differs in person with different genes. Its the combination of pharmacology that studying the effect of the drug, and genomics that studying the gene and their functions. This study could increase the safety of the drug in a certain patient.</span>
You might be interested in
Cytosine guanine thymine and adenine are referred to as phosphates. True or False
Harman [31]

Answer:

False

Explanation:

Cytosine, guanine, thymine, and adenine are collectively referred to as nitrogenous bases. These are not phosphates. The cytosine, guanine, thymine, and adenine are the four different types of nitrogenous bases. These nitrogenous bases are present in the deoxyribonucleotides. Cytosine and thymine are smaller in structure and have single ring structures. These are collectively called pyrimidines. On the other hand, adenine and guanine are the larger nitrogenous bases each with double ring structures. They are collectively called purines

6 0
3 years ago
Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!
Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the <u>coding strand</u>, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

  • Start codon ⇒ ATG
  • Stop codon ⇒ TAA, TAG, TGA

5´- GCATA<u>ATG</u>CGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCA<u>TAA</u>TGCG<u>TGA</u>TCCC<u>TAG</u>GCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATT<u>ATG</u>C-3’⇒ 1 start codon near the end

5’-TGCC<u>TAG</u>GAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. <em>However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.</em>

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0
3 years ago
Albinism is caused by a recessive mutation. If two albino mice mate and produce offspring with normal pigmentation, what could y
Nezavi [6.7K]

Answer: A geneticist studies a series of families in which both parents are normal and at least one child has albinism. The geneticist reasons that both parents in these families must be heterozygotes and that albinism should appear in  of the children of these families. To his surprise, the geneticist finds that the frequency of albinism among me children of these families is considerably greater "Than . Can you think of an explanation for the Thigher-than-expected frequency of albinism among These families?

Explanation:

8 0
2 years ago
Sylvia added five drops of bromthymol blue to a beaker of distilled water and the solution turned green. Next, she placed a drin
klemol [59]

Answer:

A) acid; [H+].

Explanation:

7 0
2 years ago
1. Who was Alfred Wegener?
azamat

Answer:

Alfred Lothar Wegener was a German polar researcher, geophysicist and meteorologist. During his lifetime he was primarily known for his achievements in meteorology and as a pioneer of polar research.

3 0
2 years ago
Read 2 more answers
Other questions:
  • How is this stratified squamous epithelium different from that observed in the esophagus?
    9·1 answer
  • 1. List 5 possible causes of desertification.
    13·1 answer
  • Problem:
    13·2 answers
  • 5. Which of the following correctly lists the kingdoms of life scientists currently use? (1 point) Terapoda, Aminota, Mammalia,
    12·1 answer
  • When DNA replication occurs before meiosis, the original DNA strand CAG TGT TTA TAG is copied into complementary strand GTC ACA
    6·2 answers
  • Describe the condition of the forests in terms of the risk of forest fires and the type or intensity of fires under the U.S. For
    8·1 answer
  • What is the name of the vitamin d-deficiency disease in adults?​
    9·1 answer
  • In a salt marsh in Georgia, the quantity of solar radiation reaching the ground during the summer is 7,000,000 cal/m2/day. The g
    6·1 answer
  • Plants that have both imperfect male and imperfect female flowers on a single plant are called (blank).
    7·1 answer
  • Why is RNA thought to have been the first genetic material? A. RNA has been found on meteorites. B. Primitive organisms, such as
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!