1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ddd [48]
3 years ago
6

What was the large, lantern-like jaw of the hominid Paranthropus boisei adapted for?

Biology
1 answer:
anzhelika [568]3 years ago
8 0
The answer would be  C
You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Individuals without AFS have a glutamic acid at position 487 on the ALDH2 protein, whereas individuals with AFS have a lysine at
azamat

Answer:

Aldehyde Dehydrogenase 2 (ALDH2) is an enzyme required to eliminate toxins such as acetaldehyde and alcohol, thereby mutations in this protein may be associated with the Alcohol flush syndrome (AFS)

Explanation:

ALDH2 is a protein required for ATP generation by catalyzing the oxidation of aldehydes to carboxylic acids (i.e., oxidation of NADH to NAD+). Mutations in the ALDH2 gene have been associated with the inactive form of this enzyme, and this specific mutation at position 487 alters its enzymatic activity associated with the metabolism of acetaldehyde and alcohol. This amino acid substitution may lead to the active site-directed inactivation of the enzyme.

8 0
3 years ago
Describe 3 ways the land/terrain change as we move from Charlotte NC to the coastal plains of North Carolina
Katarina [22]

Answer:

Hilly towards flat.

Higher elevation toward lower elevation.

Clayey to sandy type of soil.

Explanation:

The land of Charlotte NC is hilly whereas coastal plains of North Carolina is flat. Charlotte NC is located at a high elevation while on the other hand, the coastal plains of North Carolina are located at the sea and at lower height. The soil type of Charlotte NC is clay and silt whereas the soil type of coastal plains of North Carolina is sandy due to the presence of sea.

3 0
3 years ago
A neutral pH level is
Alla [95]
This would be 7. Below 7 is acidic and above is basic. 7 is neutral
7 0
3 years ago
Read 2 more answers
Portable water comes mainly from..
densk [106]
A aquifers hope that help you tried my best
5 0
3 years ago
Read 2 more answers
Other questions:
  • What is the procedure the describes the steps you use during an experiment?
    9·1 answer
  • Which characteristics do cell membranes and cell walls have in common?
    13·1 answer
  • Protists can be found ??
    10·2 answers
  • Which weighs more: a pound of feathers or a pound of lead? Explain.
    8·1 answer
  • Social mobility that occurs over the course of an individual's lifetime is called ________ mobility.
    10·1 answer
  • What property of water is responsible for water transport in plants
    7·1 answer
  • This is a diagram of a prairie food web.
    10·1 answer
  • PLEASE HELP ME ON QUESTION 10 ASAP!!!!!! GIVING 20 POINTS!!!!!!!!!!!!!!!!!!
    8·1 answer
  • Autoclaving is the most effective among all moist heat-related antimicrobial methods. (True or False)
    9·1 answer
  • Aaaa aaaaaaaaaaaaaaa aaaaaaaaaaaa
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!