1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sladkih [1.3K]
3 years ago
14

The veins of a leaf contain the _____.

Biology
2 answers:
musickatia [10]3 years ago
8 0
The answer is C because we know it's not d because a leaf is not a human
Serjik [45]3 years ago
6 0
Option c. endodermis

greek word endon, within + derma,skin; the layer of living cells, with various characteristically thickened walls and no intercellular spaces, which surrounds the vascular tissue of certain plants and occurs nearly all roots and certain stem and leaves.
You might be interested in
All life must maintain an internal balance, despite environmental changes. This is called _____.
Alik [6]
The answer would be <span>homeostasis. </span>
8 0
3 years ago
The primary function of a neuron is
Alex_Xolod [135]
Neurons, also known as nerve cells, send and receive signals from your brain. While neurons have a lot in common with other types of cells, they’re structurally and functionally unique.
8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
A is the basic unit of structure and function of living things
Sophie [7]

Answer:

Cell

Explanation:

They are the 'building blocks' of life and make up organisms.

7 0
3 years ago
Read 2 more answers
Which organelles contain enzymes that break down old cell parts?
Lena [83]

Explanation:

A lysosome is a membrane-bound cell organelle that contains digestive enzymes. Lysosomes are involved with various cell processes. They break down excess or worn-out cell parts.

6 0
2 years ago
Other questions:
  • When energy changes from one form to another, some energy is always changed to A. Electricity. B. Heat. C. Sound. D. Light.
    9·1 answer
  • Which fuel source creates the least carbon dioxide emissions?
    11·2 answers
  • Which of the following contributed to the distribution of species?
    9·2 answers
  • Drug users body grow taller to the moon and back and the side effects of the drug aposome rate
    15·1 answer
  • The time required for one complete cycle of binary fission is known as
    11·1 answer
  • ENERGY PYRAMIDS
    15·1 answer
  • Genes that are close together on the same chromosome are ___ likely to be separated during crossing over than genes that are far
    14·1 answer
  • Quick PLEASE will mark brainliest
    13·2 answers
  • Which of the following is a way that science has benefited society? a. medical advances b. new energy resources c. technological
    6·2 answers
  • Describe the similarities and differences between the features found in prokaryotic and eukaryotic plant and animal cells
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!