1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga55 [171]
3 years ago
6

PLEASE please help with these science questions, There are 5 of them!!

Biology
1 answer:
olya-2409 [2.1K]3 years ago
7 0
Ok so five times five is twenty five
You might be interested in
What is the energy source in photosynthesis? chlorophyll chemical bonds glucose light
igomit [66]

Light is the energy source in Photosynthesis!



Hope this helped!

5 0
3 years ago
Read 2 more answers
State one effect the reintroduction of the
Natali [406]

We can confirm that the reintroduction of the wolf to the ecosystem would most likely cause a decline in the population of coyotes.

<h3>Why would this cause a decline in the population of coyotes?</h3>

The wolf, in most ecosystems, is considered to be the top predator. This means that it will also hunt and consume the coyotes. This alone would cause a decline in the coyote population as they now have an additional predator hunting them. Also, the wolves would be competing with the coyotes for food sources, furthering the impact on the coyote population.

Therefore, we can confirm that the reintroduction of the wolf to the ecosystem would most likely cause a decline in the population of coyotes.

To learn more about ecosystems visit:

brainly.com/question/1673533?referrer=searchResults

#SPJ1

6 0
2 years ago
Why do rice plants include starch and protein in their seeds
Wittaler [7]
A single gene could be inserted into a plant's genome, enabling specific traits to be expressed easily. Scientists have identified genes for two enzymes needed to make pro-vitamin A. One of these genes comes from corn.
6 0
3 years ago
Read 2 more answers
In cell membranes with aquaporins can water move across the membrane?
stiks02 [169]

Answer: The cell membranes of a variety of different bacteria, fungi, animal and plant cells contain aquaporins through which water can flow more rapidly into and out of the cell than by diffusing through the phospholipid bilayer.

Explanation:

please always check over answers and hope this helps!!!

5 0
1 year ago
Which of the following is a form of stored energy?
zhannawk [14.2K]

Answer:

What are the options?

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of _____ in a dna molecule determines the protein that will be produced
    13·2 answers
  • Which of the following is the best definition of a scientific theory?
    5·2 answers
  • Which best describes red blood cells?
    5·1 answer
  • Which abnormality helps identify children with acute respiratory distress caused by lung tissue disease?
    13·1 answer
  • Organic molecules that perform many functions for living things and are made up of amino acid monomers are called
    12·1 answer
  • Why do deep-ocean vessels have very thick windows and walls ?
    8·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the following correctly indicates the order in which these events occur?
    7·1 answer
  • What is a nonrenewable resource?(1 point)
    6·1 answer
  • An earthquake’s magnitude is a measure of the _____.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!