1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iragen [17]
3 years ago
15

Question 10

Biology
1 answer:
dusya [7]3 years ago
8 0

this ones simple all the others don't use sunlight because they cant make food within themselves but plants on the other hand use direct sunlight to make their food unlike the others. ;]

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Which of the following could be done to help reduce global warming trends?
timama [110]

Answer: A. Plant more trees

Explanation: Planting more trees can reduce more pollution that is in the air.

B is wrong because by bottling up more water, it requires more plastic that may be littered on the ground. Raising more livestock is helps the environment through their feces, but it doesn't help global warming trends. Building more schools does not even reduce global warming trends at all. It may do more damage if machines that produces pollution are used during the process of building.

Hope this helps!!!


5 0
3 years ago
Select the characteristic that is exhibited by viruses to test your understanding of a third type of microorganism.
EastWind [94]
"Parasitic particles" is the one characteristic among the following choices given in the question that <span>is exhibited by viruses to test your understanding of a third type of microorganism. The correct option among all the options that are given in the question is the fourth option or the penultimate option. I hope it helps you.</span>
3 0
4 years ago
Read 2 more answers
In grafting, the plant with the root system is called the , and the portion of the plant with the buds is called the .
RSB [31]
The plant with the root system is called the rootstock


the portion of the plant with the buds is called the scion
7 0
4 years ago
Read 2 more answers
How do fungal species help other organisms in their ecosystems?
nignag [31]
Fungal species help other organisms in their ecosystems in many ways,
<span>Fungi are decomposes - they recycle the dead organs.
</span>They also maintain overall stability in ecosystem.
5 0
3 years ago
Other questions:
  • Which is an example· of a control· process· ? seriation sensory· memory· metacognition pragmatics?
    11·1 answer
  • How many cell divisions occur during meiosis?​
    15·1 answer
  • Which example best illustrates a condition for natural selection to occur
    7·1 answer
  • MULTIPLE CHOICE:
    14·1 answer
  • What does the word Transferred mean?
    15·2 answers
  • When the Barrel and Saguaro cacti absorb moisture they store it _______. a. in their roots b. in their spines c. in the flesh of
    13·2 answers
  • At what point is a star born?
    13·2 answers
  • Please help due in like 10 mins help asap willgive brianlesyt<br>only part 2
    14·1 answer
  • Helphelphelp i accidentally blocked out c and d on my last one
    6·1 answer
  • Please help, i need these note for my major test.<br> PLEASEE
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!