1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksandrR [38]
3 years ago
5

The cells that make up a human body need oxygen at all times. During periods of exercise and activity, the amount of oxygen need

ed increases. To meet this increased need, the number of breaths per minute during exercise can be sharply higher than the number of breaths per minute while at rest. Which term BEST describes the process by which cells work together to maintain the needed level of oxygen?
A) homeostasis
B) metabolism
C) osmosis
D) respiration
Biology
1 answer:
Marrrta [24]3 years ago
5 0
The correct is homeostasis
You might be interested in
The model below shows a calcium atom.
malfutka [58]

first energy level:1s2=2 electrons

2nd energy level:2s2 2p6=8 electrons

<em><u>3rd energy level 3s2 3p6=8 electrons</u></em>

4 0
3 years ago
Read 2 more answers
The protein content of lymph is highest in lymph draining from the
podryga [215]

Answer:

Thoracic duct.

Explanation:

Thoracic duct is the larger of the two lymph ducts of the lymphatic system. It is also known as the left lymphatic duct, alimentary duct, chyliferous

The thoracic duct is the largest lymphatic vessel within the human body, and plays a key role in the lymphatic system. It is also called the left lymphatic duct or the alimentary duct. A large portion of the body's lymph is collected by this duct and then drained into the bloodstream near the brachiocephalic vein between the internal jugular and the left subclavian veins.

The typical length of this duct in an adult averages between 38 and 45cm, while the diameter is about 5 to 7 mm. It originates from the second lumbar vertebra level and goes to the neck's root. The duct arises from the combination of the left and right lumbar trunks and the intestinal trunk in the abdomen.

It transports up to four liters of lymphatic fluid each day. This process is primarily caused by the breathing action and is assisted by the smooth muscle of the duct.

7 0
4 years ago
Read 2 more answers
Arrange the events in the order they would have occurred according to the theory of endosymbiosis
yanalaym [24]

Answer:

We need the events to be able to put them in order. :\

Explanation:

5 0
3 years ago
Whats the relationship between an owl and mice could be described as?
Ksenya-84 [330]
The relationship is, the owl is the predator, and the mouse is prey.
6 0
3 years ago
In three to five sentences, explain the effects of acid rain on the environment
barxatty [35]

Answer:

The ecological effects of acid rain are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife. As it flows through the soil, acidic rain water can leach aluminum from soil clay particles and then flow into streams and lakes.

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • What part of the body reproduces, grows, repairs itself, uses oxygen and nutrients, digests food, eliminates waste, produces hea
    12·1 answer
  • Tom is scheduled to have surgery next week in order to remove a large tumor from his frontal lobe. after his procedure, tom is m
    14·1 answer
  • Baker's yeast is an organism with 32 chromosomes that can perform asexual or sexual reproduction and exist as both a diploid and
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What was one of the ways that people of ancient times classified plants and animals?
    14·2 answers
  • One of the critical aspects of watson and crick's discovery of the structure of dna was that it __________.
    5·2 answers
  • Which human intervention would most likely protect and maintain kit fox populations
    15·2 answers
  • Which diagram represents binary fission?
    10·1 answer
  • 6. What blood type is shown in the picture?<br> A<br> Rh<br> B
    8·1 answer
  • In 2019, the United Nations assembled a team of scientists to conduct the biggest ever study of what?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!