All categories

3 years ago

What are some advantages and disadvantages of

Biology

2 answers:

andrew-mc [135]3 years ago

5 0

Answer:Asexual Reproduction Sexual Reproduction

Advantages Time Efficient; no need to search for mate, requires less energy Variation, Unique., organism is more protected

Disadvantages No variation - if the parent has a genetic disease, offspring does too. Requires two organisms, requires more energy

Explanation:While asexual reproduction only involves one organism, sexual reproduction requires both a male and a female. Some plants and unicellular organisms reproduce asexually. Most mammals and fish use sexual reproduction. Some organisms like corals and komodo dragons can reproduce either sexually or asexually. But in the long term (over several generations), lack of sexual reproduction compromises their ability to adapt to the environment because they do not benefit from the genetic variation introduced by sexual reproduction

kotykmax [81]3 years ago

3 0

Asexual

advantages

Time Efficient; no need to search for mate, requires less energy Variation, Unique., organism is more protected

Disadvantages

No variation - if the parent has a genetic disease, offspring does too.

Sexual

Advantages

Variation, Unique., organism is more protected

Disadvantages

Requires two organisms, requires more energy

You might be interested in

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0

3 years ago

which organelle do you think is the most important ? make a scientific argument by explaining what makes the organelle you chose

Deffense [45]

Answer:

The nucleus

Explanation:

This organelle gives all the info. Without it, the cell will die. It's like a human is alive without a brain.

6 0

3 years ago

Can someone please help me???

Deffense [45]

Answer:

Explanation:

can you take a better pic i may be able to help

6 0

2 years ago

How does carbon dioxide enter leaves?

melomori [17]

Plants get the carbon dioxide they need from the air through their leaves. It moves by diffusion through small holes in the underside of the leaf called stomata. These let carbon dioxide reach the other cells in the leaf, and also let the oxygen produced in photosynthesis leave the leaf easily.

6 0

3 years ago

A woman and a man are both heterozygous for a recessive allele for a rare genetic disease. If they have one child, what is the p

makkiz [27]

Answer:

If they have one child, the probability that he or she will be affected is 1/4.
If they have two children, the probability that at least one of them will be affected is 7/16.

Explanation:

A cross between two heterozygous Aa individuals will produce the followinf offspring: 1/4 AA, 2/4 Aa and 1/4 aa.

Since the disease is recessive, 1/4 of the offspring will have the aa genotype and 3/4 of the offspring will be unaffected.

Every time they have children new gametes were generated independently.

The probability of having no affected children both times is, according to rules of probability for independent events, 3/4 × 3/4 = 9/16 (it's the probability of having a healthy child the first time multiplied by the probability of having a healthy child the second time).

The probability of having at least one affected child is 1 - probability of no affected children = 1 - 9/16 = 7/16.

8 0

3 years ago