1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
drek231 [11]
3 years ago
5

A genome includes all the DNA in _____.

Biology
1 answer:
bixtya [17]3 years ago
7 0
This should be the correct answer

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
The following image shows a cell before and during the process of mitosis. Before it undergoes mitosis, the cell contains 2n chr
svlad2 [7]

The correct answer is B: The cells will have 2n chromosomes and be diploid.

Diploid cell have two of each chromosome, one from each parent. When diploid cell undergoes mitosis, the result is two identical diploid cells (when haploid cell undergoes mitosis the result is haploid cell). This means that during the mitosis, cells reproduce genetically identical copies of themselves.


6 0
3 years ago
Read 2 more answers
NEED HELP ASAP!!!WILL GIVE BRAINLIEST!!!!!!
aksik [14]
B - Only the Neutrons are involved in the fission reaction
4 0
3 years ago
Read 2 more answers
What Type of skeleton (ENdoskeleton, EXoskeleton, or None) do Cnidarians have
Naddik [55]
  <span>They do not possess any skeleton at al</span>
5 0
3 years ago
What is meant by heridity? ​
densk [106]

Answer:

Heredity, also called inheritance or biological inheritance, is the passing on of traits from parents to their offspring; either through asexual reproduction or sexual reproduction, the offspring cells or organisms acquire the genetic information of their parents

3 0
3 years ago
Other questions:
  • 9 times 10 to second power is ___ times grater than 3 times 10 to the -2
    10·1 answer
  • Number the steps of the binary fission process in the correct order. . Step 1 Cell wall or membrane forms. 2. Step 2 Cell grows
    10·2 answers
  • Why is it unnecessary to produce a dictionary for
    11·1 answer
  • The European buckthorn was introduced to North America as an ornamental plant. However, this plant is now a major threat to many
    7·1 answer
  • Question 5 of 9
    7·2 answers
  • What hereditary material in the nucleus of the cell is responsible for passing traits to the next generation
    13·2 answers
  • These are the 5 main
    14·1 answer
  • "Living things are found in their habitats. They interact with each other and their environment. This interaction is between bio
    12·1 answer
  • Select the item(s) that describe a producer.
    8·1 answer
  • Milk is produced in microscopic sacs called _______ and travels down _______ to the nipple. group of answer choices
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!