1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nikitich [7]
3 years ago
8

A plant is provided adequate carbon dioxide and water, but no light. In this plant

Biology
1 answer:
murzikaleks [220]3 years ago
7 0

Answer:

B. photosynthesis will not occur

Explanation:

if a plant isn't getting any sunlight, and requires it, then all production stops. You need sunlight to complete the process in photosynthesis.

You might be interested in
Can y’all help me ASAP
nadezda [96]

Answer:

tidal waves

is it so

I don't know

5 0
2 years ago
Read 2 more answers
What percentage of the Earth’s rain forests have been lost to deforestation since 1950?
White raven [17]
As a matter of fact it is 40%.
4 0
3 years ago
Read 2 more answers
What leads to an individual having too many or two few chromosomes
lyudmila [28]
Non-disjunction occurs when a the chromosomes do not split properly during meiosis resulting in too few chromosomes I believe.
4 0
3 years ago
Cơ thể người không tiêu hóa được loại đường nào?
Svetllana [295]

Answer:

Cơ thể người không tiêu hóa được loại đường nào? Cơ thể người không tiêu hóa được Xenlulozo.

5 0
2 years ago
The muscle responsible for action in a single direction is called
erica [24]
The answer is prime mover
4 0
3 years ago
Other questions:
  • Which organism in the chart below is most distantly related to the other organisms?
    11·1 answer
  • What did the miller urey experiment demonstrate
    15·2 answers
  • Heat and sunlight are both ______ that cause a reaction to plants.<br><br> HELP!!!
    10·1 answer
  • How does biology relate directly to your own life
    6·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Check the box next to the process or processes used by organism listed oak tree
    15·2 answers
  • It's important to __________ throughout your personal training plan and reset goals if necessary. A. stop training for five-day
    11·2 answers
  • If a plant were unable to produce root caps, what would be the effect on plant function?
    12·2 answers
  • Please help and explain the answer
    15·1 answer
  • Question 4: Switch on your light source. Make sure it is shining onto a wall. Hold your largest clear plastic square between the
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!