1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nevsk [136]
3 years ago
9

The ___ secretes several hormones that stimulate the development of lymphatic organs and regulates development and activity of t

cells (white blood cells).
Biology
1 answer:
user100 [1]3 years ago
7 0
The one secretes hormones for activity of t cell is thymus. The hormones called thymosin, thymosin will increase development and activity of t cells and release them into bloodstream.
You might be interested in
The raw material used by plants during photosynthesis N2and O2 O2,H2 and CO2 CO2 and water water and minerals​
strojnjashka [21]

Answer:

Thus, the correct answer is 'Carbon dioxide, water, and sunlight'.

3 0
3 years ago
What is the answer to this question?
Zepler [3.9K]
By mating with desired traits is your answer
8 0
3 years ago
Read 2 more answers
What is a source of variation in asexual reproduction ?
Vera_Pavlovna [14]
When alleles are recombined during sexual reproduction, they can produce dramatically different phenotypes. Thus, sexual reproduction is a major source of variation within many population. Asexual<span> production is when there is one parent that produces offspring that are identical to the parent. Basically a copy of the parents DNA.

Your answer in short is B
</span>
5 0
3 years ago
Help me out with this please
Schach [20]
1. Spongebob
2. Who gets the muscle cream
3. Muscle growth
4. Since the cream is advertising more muscle growth than average, patrick’s muscles should be double the size of Spongebob’s.
7 0
3 years ago
Describe the process of spermatogensis
Sedaia [141]
Spermatogenesis is the process by which haploid spermatozoa develop from germ cells in the seminiferous tubules of the testis. This process starts with the mitotic division of the stem cells located close to the basement membrane of the tubules.
8 0
3 years ago
Other questions:
  • Contrast the plate movements that cause the stresses in diagrams B and C.
    13·2 answers
  • Why do cells of plants roots generally lack chloroplast?
    7·2 answers
  • Which process will decrease the level of co2 in the atmosphere?
    5·2 answers
  • What is the control, group, experimental group, independent variable, dependent variable
    9·1 answer
  • Which of the following best describes the dependent variable in an experiment?
    8·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • !!!!!!!WILL MARK BRAINLIEST!!!!!!!!!A sudden increase in activity level can cause stress fractures.
    15·1 answer
  • Urgent!!!! Can y’all help me with this please?
    12·1 answer
  • As a result of an injury in gallbladder of a person, it had been removed surgically, which of the following processes can be aff
    15·1 answer
  • Why is evolution considered a theory and not a law
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!