1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
larisa86 [58]
3 years ago
10

Which factor of genetic code makes organisms different from one another?

Biology
1 answer:
Hatshy [7]3 years ago
4 0
The order of the codons
You might be interested in
An increase in biodiversity generally causes _______.
bija089 [108]

Answer:

c.

an increase in ecosystem stability

Explanation:

7 0
3 years ago
Read 2 more answers
How is osmosis difrent from diffusan
bulgar [2K]
Osmosis<span> is the phenomenon of the movement of Solvent molecules from lower solute conc. to higher solute conc. through a semi-permeable membrane to make solute conc. equal on both sides.</span>
7 0
3 years ago
Can someone help plzzzzzzzzzzzzzzzzzz
Lubov Fominskaja [6]

Answer:

your answer is

Bright Color

7 0
3 years ago
Read 2 more answers
How much energy is at the producer level?
Tems11 [23]

Explanation:

In a food chain, only 10% of energy is transferred from one trophic level to another trophic level. If the energy produced at the producer level is 1000 J, then the energy available at the primary consumer level will be 100 J and energy available at the secondary consumer level will be 10 J.

5 0
4 years ago
During the formation of sex cells, the type of cell that forms after meiosis I is a ______ cell.
Neko [114]

The correct answer is haploid i just took the quiz and got it right plz mark brainiest

5 0
3 years ago
Read 2 more answers
Other questions:
  • Whats the middle layer of the ocean​
    5·1 answer
  • Select all of the statements that apply to healthcare-associated or nosocomial pneumonia to test your understanding of the diffe
    6·1 answer
  • 3. Using a complete sentence describe what makes up a community? *<br><br> (Help)
    7·1 answer
  • How do diseases caused by bacteria and diseases caused by viruses react to antibiotics?
    5·2 answers
  • What does earth's crust and uppermost mantle form
    13·2 answers
  • The four techniques employed when using surface anatomy for diagnosis are
    15·1 answer
  • The center of the cross section of a root contains called​
    14·2 answers
  • Layers of sediment forming at the bottom of the ocean
    12·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • How is dna organized in the nucleus when the cell is prepared for division? how is dna organized in the nucleus when the cell is
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!