1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nutka1998 [239]
3 years ago
13

How do volcanoes form at different plate boundaries

Biology
1 answer:
frutty [35]3 years ago
8 0
Volcanoes form at different plate boundaries because of the plates divergent and convergent nature. the plates are always in motion, however minimal they may be. When the plates move apart from each other, the magma from below comes up to fill in the vacant space and thus a volcano is formed. It may be the other way round also and that is the magma forces the plates to move away and this results in the formation of a volcano. When one of plates dives under another plate, then the pressure creates melting of the mantle and thereby forms magma which in turn creates volcanoes.
You might be interested in
Cardiac muscle cells always have two nuclei true or false?
notka56 [123]

Answer:

False

Explanation:

The majority of cardiac muscle cells also known as cardiomyocytes of myocardiocytes have one nucleus even though they might have as many as four.

5 0
3 years ago
20 points !<br> 5 thoughts of artificial intelligence or Non intelligence
Fiesta28 [93]
1) self awareness
2) theory of mind
3)limited memory Al
4)Reactive Al
4 0
3 years ago
What out of this list do Eukaryotic cells have
Tju [1.3M]

Answer:Nucleoid

⬜Nucleus

⬜Mitochondria

⬜Chloroplast

Circular DNA (in nucleoid)

⬜DNA in nucleus

⬜Endoplasmic Reticulum

⬜Golgi Apparatus   Flagella Cila

Explanation

8 0
3 years ago
1. In a certain plant population, yellow seed color is recessive to green seed color. If a yellow seeded plant is crossed with a
Nuetrik [128]
Let's use A as the dominant allele for green seed colour and a as the recessive allele for yellow seed colour.
If a yellow seeded plant is crossed with a heterozygote,
aa X Aa

the yellow seeded plant would only produce one type of gamete (a) while the heterozygote would produce two different types of gametes (A and a)
If we put this into a Punnett square, we will see that there two two possible genotypes for the offsprings. Either Aa or aa.
Since the allele for green seed is dominant, Aa will exhibit the green seed colour phenotype.
Hence, the chance of getting an offspring with green seed colour is 1/2, or 0.5

8 0
4 years ago
If our atmosphere had been made up of a chemically reactive gas, what would (or would not) have happened?
never [62]

Answer:

Explanation:

If the solids were not remelted by impact as they collected to form the planet, the volatiles they carried would have been incorporated in the solid planet.

6 0
3 years ago
Other questions:
  • Energy in higher trophic levels is greater than energy at lower trophic levels.
    7·1 answer
  • Gel electrophoresis is often used in forensics. Look at the gel on the right. From the evidence DNA, which individual matches th
    14·1 answer
  • SOMEONE HELP PLEASSE!
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • 1.What is the metric system? Why might scientists prefer using metric units rather than feet or inches?
    10·1 answer
  • The ___ in the limbic system stores and stores new information.
    14·1 answer
  • How does thermal energy transfer when a room is heated by a furnace?
    12·1 answer
  • An eagle is a predator for squirrels. A new law stops humans from hunting
    6·2 answers
  • Why does the cell copy the DNA into mRNA instead of using the DNA itself to produce proteins?
    15·2 answers
  • Lab Report experiment about lima beans plant
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!