1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
borishaifa [10]
3 years ago
14

"what is the difference between a maternal-effect gene and a zygotic gene?"

Biology
1 answer:
tankabanditka [31]3 years ago
5 0
Https://www.ncbi.nlm.nih.gov/books/NBK10039/
You might be interested in
Determine the DNA sequence from which this mRNA sequence was transcribed
Kruka [31]

the convention from converting a DNA code to mRNA code is; A matches U,T matches with A,G matches with C and C matches with G

following the convention

DNA:ATGCGCAGTTATTGCGAT

mRNA:UACGCGUCAAUAACGCUA

I hoped this helped you

6 0
3 years ago
Why does active transport take place in the small intestine during absorption of food molecules? I thought it was only diffusion
dezoksy [38]
Well if the small intestine needs to absorb the nutrients, then the nutrients kind of have to go somewhere right?
also, there is a transfer from high to low
inside the small intestine there are lots of nutrients that need to be absorbed to be made into energy
the cells would only have to take in more nutrients if it has run out, aka it's low on nutrients
thus the high concentration outside the cell and the low concentration inside leads to the active transport through the cell membrane
3 0
4 years ago
The Burmese python has been released by people who were not prepared to care for them as pets into the Florida Everglades. The p
aivan3 [116]

Answer:

B - invasive species

Explanation:

Invasive species are species that are not native to a particular habitat but are introduced into that habitat intentionally or by accident.

The Burmese python was released in Florida (where it is not a native species). Because it is not from Florida, it does not have any natural predators there, and it can seriously damage the ecosystems by preying on organisms that have no adaptations against the new predator.

8 0
3 years ago
Read 2 more answers
Do multicellular organisms GROW? Do multicellular organisms DEVELOP
maxonik [38]

Answer:

It has physically increased in size. Often, growth of a multicellular organism occurs as more cells are created. In unicellular organisms (like bacteria), growth still occurs. ... For this reason, most biologists will tell you that development only occurs in multicellular organisms, not in unicellular ones.

4 0
4 years ago
I really need help in biology please
Morgarella [4.7K]

Answer:

What is the genotype for a h0m0zygous dominant plant? PP

What is the phenotype? Purple plants

What is the genotype for a h0m0zygous recessive plant? pp

What is the phenotype? White plants

What is the genotype for a heterozygous plant? Pp

What is the phenotype? Purple plants.

What is the genotype for a h0m0zygous dominant for freckles? FF

What is the phenotype? Freckles

What is the genotype for a h0m0zygous recessive for freckles? ff

What is the phenotype? No freckles

What is the genotype for a heterozygous individual for freckles? Ff

What is the phenotype? Freckles.

Each individual has two alleles for a given gene.

For example, the allele dimples are dominant. How would you represent this allele? With capital letters, for example, DD.

The allele for no dimple is recessive. How would you represent this allele? With lowercase letters, for example, dd.

The allele for brown eyes is dominant. How would you represent this allele? With capital letters, for example, BB.

The allele for blue eyes is recessive. How would you represent this allele? With lowercase letters, for example, bb.

PP: h0m0zygous dominant; Yy: heterozygous; Ss: heterozygous; bb:h0m0zygous recessive; FF: h0m0zygous dominant

Explanation:

Every being, such as plants, animals, or humans, have two different copies of a gene. These are alleles. These copies can be dominant or recessive.

Dominant genes are the ones that we will see. They "hide" the recessive gene. Recessive genes are the ones that we will only express if the two alleles are recessive since there is no dominant gene that hides the other.

Genotype is the genes that an individual or animal has. We can not see it. For example, a person can have a dominant trait for blue eyes and a recessive trait for brown eyes (Bb)s. In other words, it is the genetic information that a person carries. The phenotype is what we can see of a trait. Following the previous example, the dominant trait is blue eyes, and the recessive is brown, so the gene that will express itself is blue eyes, and we will able to see it.

The pair of alleles can be h0m0zygous and heterozygous. H0m0zygous is when the two traits are the same, for example, BB or bb. Heterozygous is when the traits are different, like, Bb.

Pea plants have two flower varieties where purple is dominant over white. The dominant trait, we represent it with a capital letter, in this case, P, because it is the first letter in purple. The recessive trait we represent it with a lowercase letter, in this case, p.

The genotype for a h0m0zygous dominant plant would be PP. We have to remember that the genotype is the information that the plant carries. If this information is h0m0zygous, it means the two alleles are the same, and if they are both dominant, we write capital letters. The phenotype is what we can see of the information; the gene that it is expressed, in this case, would be the color purple.

A h0m0zygous recessive plant has two alleles with the same information, and as they are recessive, we write two lowercase letters (pp). The genotype would be white plants since there is no dominant allele that covers the recessive one.

In a heterozygous plant, the traits are different. We have the dominant trait purple (P) and the recessive trait white (p). The dominant is the one that will express itself and the one that we will be able to see, see in a purple plant.

The following questions are similar to the first one. We know that freckles are a dominant trait, so we use a capital letter to represent it (F) and a lowercase letter to portrait the recessive trait, which is no freckles (f).

A h0m0zygous dominant means that the two alleles are the same and that one does not hide the other so, the genotype would be FF, and the phenotype would be a person with freckles.

If the person is h0m0zygous recessive, it means that it has the same traits, but one allele does not hide the other. The genotype would be ff, and the phenotype would be no freckles.

In the last case, the person is heterozygous, which means that it has one dominant and one recessive allele. The dominant allele will express itself; the genotype would be Ff, and the phenotype freckles.

In the following questions, we know that we represent dominant alleles with capital letters and recessive ones with lowercase letters, if it is a dominant allele for brown eyes, we write BB, taking the first letter of the dominant trait, in this case, brown. If it is a recessive trait, we write lowercase letters, in this case, bb for blue eyes.

In the last set of questions, we have to observe the letters to find the genotype.

PP, FF: the two letters are the same, which means that the allele is h0m0zygous. Also, they are both in capital letters, so they are dominant traits. Yy, Ss: the two letters are different, one is in capital letters, and the other is not. The allele is heterozygous. bb: the two letters are the same, so they carry the same information. They are h0m0zygous. Both of them are in lowercase, so they are recessive alleles.

5 0
3 years ago
Other questions:
  • True or false?. a placebo is a substance that elicits no response in an experimental subject.
    14·2 answers
  • Condition without pulse (loss of consciousness that occurs when the body cannot get the oxygen it needs to function -
    13·1 answer
  • Iple Choice Questions (US)
    14·1 answer
  • Community A has 21 species. of the 110 individuals, there are 50 individuals of one species and 3 each of the other 20 species
    8·1 answer
  • Which is the largest percentage of soil?
    8·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • A population of 8,250 mice occupies the sand dunes in a coastal area. A severe hurricane washes out several miles of sand dunes.
    10·1 answer
  • Help no links or you'll be reported
    15·1 answer
  • List five women rights​
    7·2 answers
  • Which statement is evidence of the effects of the availability of resources on the number of wolves or caribou?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!