1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovangra [49]
3 years ago
11

How many neutrons does element X have if its atomic number is 25 and its mass number is 92?

Biology
2 answers:
inna [77]3 years ago
8 0
Atomic mass is the sum of neutrons and protons, and atomic number is the number of protons.
Therefore, 92-25 = 67.

67 neutrons.

Sidenote:
Electrons are not considered in atomic mass since they weigh way too little
Deffense [45]3 years ago
3 0
Atomic mass is the sum of neutrons and protons, and atomic number is the number of protons.
Therefore, 92-25 = 67.

67 neutrons.

Sidenote:
Electrons are not considered in atomic mass since they weigh way too little
You might be interested in
A) In how many cases in the genetic code would you fail to know the amino acid specified by a codon if you knew only the first t
Vesna [10]

Answer:

a) 28 cases

b)  3 cases

Explanation:

a) From the table of genetic codes, there are 28 codons that specify more than one amino acid assuming only the first two nucleotides are considered. In these cases, one cannot outrightly specify the amino acid the genetic codes are coding for without knowing the last nucleotide of the codes. <em>For example, UU can be for Phenylalanine or Leucine, CA can be for Histidine or Glutamine, etc. </em>

b) From the table of genetic codes, the first two nucleotides of Arginine can be either of CG or AG, that of Serine can be either of UC or AG while that Leucine can be either of CU or UU. Only in these <u>3 cases</u> would one fail to know which are the first two nucleotides assuming the name of the amino acids are given.

<em>See the attached image for the genetic code.</em>

7 0
3 years ago
A mixture of the amino acids leucine, glutamate, and arginine, is added to a cation exchange column at neutral ph. in what order
natulia [17]

Cation-exchange chromatography is used when the molecule of interest is positively charged, the stationary phase is negatively charged and positively charged molecules are loaded to be attracted to it. So, the amino acids with negative charge will elute the first. Glutamate, leucin, arginine is the order of elution because of their pI values ~3,  ~6  ~10.

5 0
3 years ago
(SCIENCE)
Serjik [45]
A is your answer I believe because they do indeed provide a way to review other scientists work and or experiments
7 0
3 years ago
Read 2 more answers
Explain why people sleep under mosquito nets in some parts of the world​
Virty [35]

Answer:

A mosquito net is a type of meshed curtain that is circumferentially draped over a bed or a sleeping area, to offer the sleeper barrier protection against bites and stings from mosquitos, flies, and other pest insects, and thus against the diseases they may carry

3 0
3 years ago
Read 2 more answers
An organisms haploid number if its diploid number is 32?
djverab [1.8K]

Answer:

The haploid (n) number would be 23 chromosomes found in the gametes, reproductive cells of sperm and ova. For the organism in this example the diploid (2n) number is 12 making the haploid (n) number would be half of that or 6 chromosomes

5 0
3 years ago
Read 2 more answers
Other questions:
  • When a muscle cell demands energy to contract, what happens to ATP?
    8·1 answer
  • These are four types of feathers found in birds. The structure of these feathers is most likely composed of...
    6·2 answers
  • Please I need help with questions 72 and 73 and it’s very hard and I’m struggling with it and if you need to see the picture big
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which of the following statements correctly explains a wave in the open ocean?
    10·2 answers
  • When the diaphragm contracts, the size of the thoracic cavity ________, the pressure inside the thoracic cavity ________, and ai
    7·1 answer
  • Give the number of protons, neutrons and electrons in the lithium atom shown in the
    5·1 answer
  • What is the chromosome number for each is cell division occured
    13·1 answer
  • Match each organ system with its main function.
    14·1 answer
  • Elotes and esquites are made from what type of vegetable?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!