My Answer: Vestigial organs
Why?: " Vestigial organs are physical structures that were fully developed
and functional in an ancestral group of organisms but are reduced
and unused in the later species."
Hope I helped! :D
Answer: Lets choose a food processing company for scientific study.
Explanation:
Scientific study is the study which involves taking observations on the samples being studied experimentally. Drawing evidences from observations to prove a scientific fact.
In a food based company, several scientific tests are required to be done to check the shelf-life, quality, quantity of the ingredients, and to check whether they are fit for consumption or not all of these parameters have to checked through experimental procedures.
Answer:
The Lungs
Explanation:
Asthma is a lung disease that affects your airways. With asthma, the lining of your airways is constantly hypersensitive, resulting in redness and swelling (inflammation). It's similar to how sunburned skin turns red, irritated, and sensitive. The airways become hypersensitive to things you are exposed to on a daily basis, or asthma "triggers." a trigger could be a common cold, stress, changes in the weather, or environmental factors like dust, chemicals, smoke, or pet dander.
Airway remodeling can occur as a result of poor asthma management. When asthma is untreated or poorly managed, it can lead to airway remodeling, which is a serious condition. The lungs become scarred, asthma medications become less effective, and less air can pass through your airways. It is not necessary to remodel the airways.
Hope this helps and if it does, don't be afraid to give my answer a "Thanks" and maybe a Brainliest if it's correct?
Carbon atoms are converted into metabolites like acetic acid, lactic acid, aldehydes, etc via the action of different bacteria. In the process of fermentation or cellular respiration, carbon atoms are cleaved into three carbon molecule called pyruvate then eventually forming into metabolites.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
