Due to the cold temperatures then More cod would be driven away from the Georges Bank. The scientific reason for this option is that c<span>older temperature will cause the concentration of oxygen to drop in the water and solubility will increase with temperature.</span>
Answer:
In the given case, it is clear that the sympathetic part of the autonomic nervous system is on in Mr. T. It can be suggested due to the increase in heart rate and appearance of cold and pale skin in the patient's upper body. The sympathetic nervous system is the component of the ANS, which is an extensive network of neurons that monitor's the involuntary processes of the body.
Mainly, the sympathetic nervous system monitors the features of the body associated with the fight or flight response like increasing heart rate, mobilizing fat reserves, and discharging adrenaline. Apart from this, the increased heart rate and vasoconstriction will assist in elevating the patient's blood pressure.
Answer:
Ok
Explanation:
Photosynthesis is the processes whereby plants and other organisms convert light into chemical energy.
This answer is probably true, because mammals are very intelligent creatures.
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
