1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna35 [415]
3 years ago
10

True or False. Water stayed in the straw activity we did because of water pressure.

Biology
2 answers:
Alinara [238K]3 years ago
8 0

Answer:

true

Explanation:

Vanyuwa [196]3 years ago
4 0

Answer:

2

Explanation:

because it being pressure

You might be interested in
What effect would decreasing water temperatures have on the cod population in the Georges Bank?
bixtya [17]
Due to the cold temperatures then More cod would be driven away from the Georges Bank. The scientific reason for this option is that c<span>older temperature will cause the concentration of oxygen to drop in the water and solubility will  increase with temperature.</span>
3 0
4 years ago
You’re doing a clinical at the local hospital when you meet Mr. T, a 23-year-old man who has suffered a complete spinal injury a
tankabanditka [31]

Answer:

In the given case, it is clear that the sympathetic part of the autonomic nervous system is on in Mr. T. It can be suggested due to the increase in heart rate and appearance of cold and pale skin in the patient's upper body. The sympathetic nervous system is the component of the ANS, which is an extensive network of neurons that monitor's the involuntary processes of the body.  

Mainly, the sympathetic nervous system monitors the features of the body associated with the fight or flight response like increasing heart rate, mobilizing fat reserves, and discharging adrenaline. Apart from this, the increased heart rate and vasoconstriction will assist in elevating the patient's blood pressure.  

5 0
3 years ago
What is photosynthesis? Read my bio!​
schepotkina [342]

Answer:

Ok

Explanation:

Photosynthesis is the processes whereby plants and other organisms convert light into chemical energy.

5 0
3 years ago
Mammals have well-developed brains that are more specialized than any other class of animals.
quester [9]
This answer is probably true, because mammals are very intelligent creatures.
6 0
4 years ago
Read 2 more answers
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Eddi Din [679]

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

4 0
3 years ago
Other questions:
  • At the base of the brain is the _____, which controls the pituitary gland and maintains homeostasis. hypothalamus cerebrum cereb
    11·2 answers
  • Two fruit flies, one with red eyes and one with white eyes mate and have an offspring with white eyes. having red eyes is a domi
    7·1 answer
  • Question 8 of 10
    15·1 answer
  • A 78 year old grandmother presents for eval of weakness in her face. She has a longstanding history of HTN that has been under f
    7·1 answer
  • A bone tumor disrupts the normal structure of osteons, replacing the organized rings with disorganized, irregular masses of bone
    10·2 answers
  • What is permutations?​
    7·2 answers
  • 10. The butterfly's wing looks different in the different photos because
    11·1 answer
  • 1. Explain using diagram how monomers are arranged in Thermoplastic and Thermosettingplastics.​
    5·1 answer
  • A scientist who studies a group of mice and the area in which they live would be studying a(n):
    14·1 answer
  • Answers for Disruptions of the Cell cycle quick check
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!