1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sidana [21]
3 years ago
7

Which label should Megan add to complete her chart?

Biology
1 answer:
GREYUIT [131]3 years ago
7 0

Answer:

Megan should add Maple, 39%

OAmalOHopeO:

You might be interested in
What releases toxins that can kill marine life?
strojnjashka [21]
The toxins are the substances which decreases the conc. of oxygen in wzater and increase toxicity
6 0
3 years ago
An enzyme contains a catalytic histidine residue in its active site that must release an R group proton to solution in order to
hjlf

Options missing:

a) The pH of the environment should be relatively high.

b) The pH of the environment should be relatively low.

c) The pH of the environment would not matter.

d) The environment should be set to the biochemical standard state.

Answer:

a) The pH of the environment should be relatively high.

Explanation:

For optimal function an enzyme needs a certain environment or condition. As temperature increases, the rate of enzyme activity also increases. As temperature increases toward its optimum point of 37 degrees Celsius (98.6 F), hydrogen bonds relax and make it easier for the hydrogen peroxide molecules to bind to the catalase.

The part of the enzyme where this reaction takes place is called the active site. A temperature that is higher or lower than this optimum point changes the shape of the active site and stops the enzyme from working. This process is called denaturation.

Enzyme pH levels also change the shape of the active site and affect the rate of enzyme activity. Each enzyme has its own optimal range of pH in which it works most effectively. In humans, catalase works only between pH 7 and pH 11. If the pH level is lower than 7 or higher than 11, the enzyme becomes denaturated and loses its structure. The liver sustains a neutral pH of about 7, which creates the best environment for catalase and other enzymes.

General acid catalysis would require histidine to be protonated at pH values (pH 8.0) optimal for enzymatic activity which is relatively high.

3 0
3 years ago
If a red blood cell has no A or B proteins on it but does have Rh proteins, what blood type is the red blood cell?
muminat
O+ (O positive) if you have neither A nor B antigens but you have rhesus antigens.
5 0
3 years ago
Which is a symptom that is typical in people who have cancer? resistance to insulin sores that do not heal onset of a gluten all
Ainat [17]

It was sores that don't heal got the question wrong because of the other answer posted here smh

3 0
3 years ago
Read 2 more answers
SI units are based on multiples of what number?
Romashka-Z-Leto [24]
SI is a base 10 standardized system. I hope this helped and if not I highly recremend talking to your teacher or a parent.
4 0
3 years ago
Other questions:
  • Digestion includes breaking substances into their simpler building blocks, synthesizing more complex cellular structures from si
    12·1 answer
  • Why is water important for digestion
    13·1 answer
  • A child falls and suffers a deep cut on her leg. The cut went through her skin and she is bleeding. Which of the following defen
    8·1 answer
  • Which of the following is not a characteristic of all life
    7·1 answer
  • Negative consequences that may result from an abundance of nutrients in Lake Okeechobee
    10·1 answer
  • According to the modern theory of evolution, ...
    14·1 answer
  • Help on these please
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • How do scientist test thier hypothesis
    15·2 answers
  • Jupiter takes 4,332 Earth days to orbit the Sun, while Mercury takes 88 Earth days. Why is Mercury able to orbit the Sun more qu
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!