1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tekilochka [14]
3 years ago
6

14. A filter feeding mollusk is the a. Moon snail b. Mussel C. Mud snail d. Whelk

Biology
2 answers:
stealth61 [152]3 years ago
8 0

Answer:

(B) Mussels

Explanation:

Mussels are a filter feeding mollusk.

The mussel circulates its food through its system before eating it. Since the mussel lives in water and it food does as well, the mussel doesn't want to eat tons of water, so it needs to get rid of it as well as the other un-needed things.

a_sh-v [17]3 years ago
3 0

Answer: option D - Whelks

Explanation:

Whelks are molluscs with a radula on a stalk that can extend beyond the shell and be used to bore into the shells of other molluscs.

Through these holes that they have bored they poke the tip of the radula and suck out the flesh of the victim.

You might be interested in
Which of the following is NOT part of
STatiana [176]

From the options B is not part of the study of science is : ( B ) The ethics of new developments

Analyzing the evidence gotten from an experimental or research study is a core part of science because that way the scientist can determine if the results obtained are close to the predicted hypothesis or outcome.

Science involves the study of the natural world because all scientific experiments and researches are carried out by studying real life ( natural world ) as study cases.   while the ethics of new developments is not controlled or determined  by  the scientist

Hence we can conclude that the ethics of new developments are not part of the study of science

Learn more : brainly.com/question/497944

4 0
3 years ago
What is the type of mouth part found in the female anopheles?
blagie [28]

Answer:

Piercing and sucking mouthpart

Explanation:

Hope it helps.

7 0
3 years ago
Which sentence accurately describes star clusters?
Elza [17]

Answer:

Stars form large groupings

Explanation:

A large group of stars that have a common origin and are gravitationally bound for some length of time is called star clusters. Star clusters provide a way to study the ages of stars and stellar evolution. There are two categories of star clusters i.e. galactic clusters, and globular clusters.

Out of the given options, we can say that the correct option is (b) "Stars form large groupings".

4 0
3 years ago
Read 2 more answers
What is true about genetic mutations?
Nat2105 [25]
C) Most are negative
8 0
4 years ago
"Could you please help me? I have a question that is honestly NOT a homework
iren2701 [21]
It is not common but yes an ab parent can have an O child
3 0
3 years ago
Other questions:
  • If a cell in g1 has 40 chromosomes, then at the end of meiosis i there will be _________ chromosomes in each daughter cell, and
    11·1 answer
  • Why adaption is important​
    14·1 answer
  • Which type of succession do the biotic components of a community cause?
    6·2 answers
  • What is responsible for making an axle spin in an electric motor
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Please help meeee ! ​
    14·2 answers
  • Type of nutrition shown by all fungi​
    13·1 answer
  • Identify the tissues and write their main functions<br><br>9 to 11 carries three marks each​
    6·2 answers
  • What do you think could happen to the enzyme lactase at the end of the reaction
    7·1 answer
  • PLEASE HELP QUICK, 100 POINTS AND BRAINLIST.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!