1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jasenka [17]
2 years ago
12

What is the main function of nucleic acids ansers.com?

Biology
1 answer:
Maslowich2 years ago
4 0
To carry genetic materials
You might be interested in
The organisms in a community are independent. what does this mean?
Olenka [21]

It would mean that the organisms rely on each other for survival.

Hope this helps (:

3 0
3 years ago
Eukaryotic cells of humans and animals possess a selective advantage in the fact that
schepotkina [342]
D. I,III and V

This is correct because all of the following occur during anaerobic respiration. (I took AP Bio :) )
7 0
3 years ago
Which of the following elements is found in all organic molecules
Mnenie [13.5K]

Answer:

The three elements that make up over 99 percent of organic molecules are carbon, hydrogen and oxygen.

Explanation:

5 0
3 years ago
Which mechanism helps prevent errors during DNA replication?
Dmitrij [34]
Each nucleotide only pairs with one nucleotide
6 0
3 years ago
What are the reactants of cellular respiration?
tia_tia [17]

Answer:

Explanation:

‍♂️

6 0
2 years ago
Read 2 more answers
Other questions:
  • 5. a. Identify and name the rock in the picture below.
    14·2 answers
  • What is The uncondensed dna present in the nucleus
    12·1 answer
  • How much kidney filtrate is reabsorbed back into the vascular system?
    8·2 answers
  • Which phrase describes foliated rocks?
    9·2 answers
  • What is not considered a lymph node function?
    9·1 answer
  • A mutation that resulted in the loss of inner hair cells within the organ of corti would be expected to result in
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Where<br>is testosterone produced?<br>​
    5·1 answer
  • If this molecule were broken down, would it provide all of the elements needed to assemble lipids, nucleic acids, or proteins?
    11·1 answer
  • What does cellular respiration provide that plants can use in photosynthesis
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!