1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Advocard [28]
3 years ago
10

Non Examples of asexual and sexual reproduction

Biology
2 answers:
kolezko [41]3 years ago
8 0

Answer:

Some plants and fungi go through the asexual reproduction process. Mammals go through the process of sexual reproduction.

Explanation:

Asexual reproduction is the simplest way for one individual to give birth to another. In this type of reproduction, the next generation acquires the same characteristics that their parents have, since they receive equal copies of the DNA, that is, they are clones. In this one, there is no encounter of gametes nor fertilization. On the other hand, sexual reproduction consists in the union of the male and female gametes, forming the zygote that will give rise to a new being. It is through reproduction that genetic information is transmitted between generations. Each originated individual inherits the genetic material from his parents.

posledela3 years ago
6 0
A Chameleon and a Camel
You might be interested in
Most stars end their lives as which type of star?
mestny [16]
A white dwarf is the answer
6 0
4 years ago
Que tipos de ARN hay en nuestras células
Ymorist [56]

Answer:

ARN mensajero (ARNm), ARN ribosómico (ARNr) y ARN de transferencia (ARNt)

3 0
3 years ago
The regulation of body temperature exclusively from the external environment is referred to as
Oksana_A [137]
I believe that you're question is referring to homeostasis
8 0
3 years ago
The differences between each stage of consciousness are easy to recognize.<br> True or False.
AleksandrR [38]
<h2>The answer is </h2>

False

<h2>Explanation:</h2>

According to Sigmund Freud human consciousness have been divided into three levels of awareness: the conscious, precociousness, and unconscious. These stages are never understood by any person at the same time. There is always a transition period between these segments. For example the transition stage from wake to sleep where we see a gradual reduction in consciousness with fuzzy, halfway states in between conscious and unconscious.

6 0
3 years ago
Read 2 more answers
Which of the following is NOT transported by vascular tissue?
Sholpan [36]
Which of the following is NOT transported by vascular tissue?
Vascular tissue is transporting food, water, and hormones.  <span>4.None Of The Above
Vascular tissue distributes blood which carries food, water, and hormone. They also distribute oxygen and take carbon dioxide to the distant cells.</span>
5 0
3 years ago
Other questions:
  • Describe the relationship between ATP and ADP and the importance of this relationship within a cell. (10 points)
    8·2 answers
  • if there is no oxygen during the cellular respiration process, the Krebs cycle does not occur. True or False
    9·2 answers
  • Holding one's head slightly down when racewalking will make breathing more difficult.
    7·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Difference between inhalation and exhalation???
    10·2 answers
  • Convection currents transfer thermal energy ___? A. Between continents B. From cooler regions to warmer regions C. From warmer t
    13·2 answers
  • The scientist who in 1758 created a system that is the basis of the modern system of classification of organisms is __________.
    15·1 answer
  • John James Audubon and Henry David Thoreau had an important influence over the ____
    11·1 answer
  • Pls help. will mark brainliest
    12·2 answers
  • Substance A is transported from the plasma of the peritubular capillary into the fluid of the renal tubule. Substance A is said
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!