1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
6

During transcription what happens to the RNA polymerase if a repressor protein attaches to the operator

Biology
1 answer:
Ivanshal [37]3 years ago
6 0

Answer:

It cannot attach to the promoter.

Explanation:

idk

You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
GUYS PLSS HELP if you know!!! ASAP!!
inessss [21]

Answer:

your answer is positive b

4 0
4 years ago
Read 2 more answers
Which describes a population that has reached the largest number of individuals that the environment can support over a long per
strojnjashka [21]
It is a. Has no limiting factors
6 0
3 years ago
An air mass forms over the North Pole region describe what you think the temperature and humidity of this air mass will be like?
soldi70 [24.7K]

Answer: hope this helps :)

The motion of air mass motion is usually based upon the air flow in the upper atmosphere. As the jet stream changes intensity and position, it affects the motion and strength of air masses. Where air masses converge, they form boundaries called "fronts".

3-D view of a cold front.

Fronts are identified by change of temperature based upon their motion. With a cold front, a colder air mass is replacing a warmer air mass. A warm front is the opposite affect in that warm air replaces cold air. There is also a stationary front, which, as the name implies, means the boundary between two air masses does not move.

The motion of air masses also affects where a good portion of precipitation occurs. The air of cold air masses is more dense than warmer air masses. Therefore, as these cold air masses move, the dense air undercuts the warmer air masses forcing the warm air up and over the colder air causing it to rise into the atmosphere.

So, fronts just don't appear at the surface of the earth, they have a vertical structure or slope to them as well. Warm fronts typically have a gentle slope so the air rising along

6 0
2 years ago
During osmosis, water molecules move across the cell membrane.
Ivanshal [37]
True tehehehehehehhee
5 0
3 years ago
Other questions:
  • The chemical energy stored in ATP during photosynthesis os released during the dark phase to
    8·1 answer
  • True or false as a wave approaches the shore friction causes the wavelength to grow longer?
    13·2 answers
  • What is a high speed, high altitude wind that moves air masses?
    14·1 answer
  • What is the primary form in which oxygen is carried in blood?
    8·1 answer
  • Which receptors have been found useful for decreasing cancer cells?
    10·1 answer
  • How do Vaccines Work?
    9·2 answers
  • Hey can someone explain what happens in the "prophase" stage of cell division??
    8·1 answer
  • Match each root with its meaning.
    7·1 answer
  • 16. variables that are kept the same in all groups
    12·1 answer
  • 2. Where does fertilization take place in humans?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!