1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maksim231197 [3]
4 years ago
13

what is the scientific term for rocks that were formed from magma A intrusive B gabbro C extrusive D lava

Biology
2 answers:
dimaraw [331]4 years ago
5 0

the answer is C: Extrusive

Zanzabum4 years ago
4 0
C extrusive rocks it is I think
You might be interested in
Worms break down dead plants in the soil to release nutrients. Which property of nutrients shows that they are a type of matter?
podryga [215]

Decomposition- the break down of dead organisms.

6 0
3 years ago
Which of the following types of models is most likely to be used to predict earthquakes?
8090 [49]

Answer:

its B

Explanation:

3 0
3 years ago
Which months weather is most similar to April ​
loris [4]
March and January would be the most similar
6 0
3 years ago
1. Ms. L's symptoms include shortness of breath, a chronic cough productive of thick mucus,
Elina [12.6K]

The small cell extensions that beat to create an up-ward current are called microvilli.

<h3>What are microvilli?</h3>

Microvilli are small extensions which are found on the surface of the alveoli of the lungs.

The microvilli play an important role in the lungs as the help to remove particles and mucus that may obstruct the lungs as a result of the upward current they create in the lungs from their beating motion.

Therefore, the paralyzed small cell extensions that beat to create an up-ward current are called microvilli.

Learn more about lung microvilli at: brainly.com/question/12993303

#SPJ1

3 0
2 years ago
HELP PLEASE ANSWER ANY OF THEM:
Leviafan [203]
The start Codon is the first mRNA
6 0
4 years ago
Other questions:
  • What might happen if the testes were located inside the body?
    15·1 answer
  • Changes in the genetic make-up are normally_____to the organism.
    8·2 answers
  • Temperate rainforest animals
    9·1 answer
  • What is metrotrops ?​
    11·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  •  Efficiency is 
    13·1 answer
  • Staphylococcus aureus produces ________, an enzyme that results in the accumulation of fibrin around the bacterial cells.
    9·1 answer
  • 5. Which of the following is incorrect combination of disaccharide sugar? A. Maltose glucose + glucose B.Sucrose galactose + fru
    15·1 answer
  • When ATP is converted to ADP, ____
    15·1 answer
  • An itemt hat is free of all viable microbes including endospores is considered to be?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!