1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
2 years ago
15

Showing change in the composition of a population's gene pool demonstrates that evolution has occurred.

Biology
1 answer:
Anna11 [10]2 years ago
8 0
A. true, evolution does occur
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Salt is notoriously dangerous to land snails; however, some populations of aquatic, freshwater snail have brackish (or a mix of
Mashutka [201]

Answer:

The brackish water adaptation is clearly necessary because the aquatic snails need to live in an environment in which the river system has a higher quantity of salt than what land snails can take. I can determine that the environmental factors influenced the inherited adaptations because the second population has a higher salt concentration in their habitat compared to the initial population.

8 0
3 years ago
Need people to talk to and maybe a bit of role play but mainly talk
alexandr402 [8]

Answer:

what do you want to talk about?

4 0
3 years ago
Read 2 more answers
Six examples of vectors​
schepotkina [342]

Answer:

Mosquitoes West Nile Virus St. Louis Encephalitis Western

6 0
2 years ago
Read 2 more answers
What appears to be the role of sirna in destroying the target mrna upon which it and its associated proteins act? it cleaves the
Romashka-Z-Leto [24]
<span>siRNA guides the RISC that cleaves the target mRNA. siRNA binds to its target mRNA due to its complementarity.</span> <span>Small interfering RNA (siRNA) has a function in RNA interference, which means it causes gene silencing through repression of transcription. siRNA together with some proteins (like Argonaute) form the RISC. When siRNA recognize the target mRNA it causes degradation of mRNA and thus silencing the gene that encodes that mRNA.</span>
8 0
3 years ago
Other questions:
  • Ribosomal RNA is produced by (a)lysosomes (b)nucleoli (C)mitochondria (d)Golgi bodies
    6·1 answer
  • A student creates a model of a closed ecosystem by filling a glass tank half full with water then addin 10 snails and two small
    11·1 answer
  • A student is examining leaf cells. Which organelle is most likely to be missing from the cells?
    11·1 answer
  • Imagine a population of Galápagos finches that vary for bill size. If the population mean is near the optimum size for eating th
    7·1 answer
  • The cell cycle involves the growth, replication, and division of a eukaryotic cell. Mitosis most directly plays a role in
    7·2 answers
  • Describe DNA’s important genetic role in a few sentences below.
    15·2 answers
  • how does water role in photosynthesis explain increased biological productivity in area of heavy precipitation​
    7·1 answer
  • Rhizobacteria are a group of bacteria that live in nodules on plant roots. Rhizobacteria can produce IAA and convert atmospheric
    15·1 answer
  • What kind of boat is this
    15·1 answer
  • What is compost manure ?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!