The appropriate answer for this one is C. Cancer cells divide uncontrollably and therefore the cell cycle would be continuously divide. To add, t<span>here is a term known as terminally differentiated cells. These cells that never enter the cell cycle again, meaning they stay in G0 and never divide. However, some cells can be triggered to depart G0 and re-enter G1, which permits them to divide again.</span>
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Yea of course the use one
A tectonic plates
Because the outermost part of earth is know as the lithosphere. The lithosphere is divided into a number of tectonic plates. These plates move and interact with one another, driven by conventional forces within the earth
