All categories

3 years ago

When a doctor suggests following a diet low in saturated fats, which of these products is preferred when cooking?

1 answer:

n200080 [17]3 years ago

8 0

When a doctor suggests following a diet low in saturated fats, oils with double bonds between their carbon atoms is preferred when cooking. The correct answer between all the choices given is the second choice or letter B. I am hoping that this answer has satisfied your query and it will be able to help you in your endeavor, and if you would like, feel free to ask another question.

You might be interested in

What is a void?

snow_tiger [21]

2 is the right answer

4 0

3 years ago

What is the difference between accuracy and precision in scientific measurements?

Jlenok [28]

Answer:

Explanation:

In scientific measurement,

Accuracy refers to the closeness of a measured value to a standard or specific value while precision is the level of agreement of a particular measurement with the measured value it is repeated.

3 0

3 years ago

Which set of statements best explains the relationship between the parts of the respiratory system?

Sloan [31]

Answer:

Explanation:

3 0

3 years ago

Blology Period 3

musickatia [10]

Answer:

Label A

✔ nucleus

Label B

✔ cytoplasm

Label C

✔ ribosomes

Label D

✔ DNA

Label E

✔ cell membrane

Explanation:

5 0

2 years ago

Read 2 more answers

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0

2 years ago