1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
3 years ago
12

Need this as fast as Possible!!!!! I will put you for the Brainliest if you answer ALL and Get them RIGHT!!!! HURRY

Biology
2 answers:
LUCKY_DIMON [66]3 years ago
8 0
<span>The answer to 10 is A as liquids expand with an increase in temperature. 12. Not able to answer. The answer to 17 is A as a the two different metals expand and contract at different rates when heated and cooled.</span>
NemiM [27]3 years ago
5 0
<span>B. The volume of water will increase if cooled from 3°C to 2°C

I JUST TOOK THE EXAM !!!!</span>
You might be interested in
Which characteristic distinguishes the five groups of fungi
Naya [18.7K]

Answer:

don't

Explanation:

here is your answer

8 0
2 years ago
Read 2 more answers
Luteinizing hormone is bound to transport proteins in the plasma. <br> a. True<br> b. False
Tanzania [10]

Answer:

FALSE

Explanation:

Luteinizing hormone, also known as the lutropin, is a heterodimeric glycoprotein produced by the gonadotropic cells of the anterior pituitary gland.

The function of the luteinizing hormone in males is the secretion of the progesterone hormone. Whereas, in females, the acute rise of this hormone triggers ovulation, maintains the corpus luteum and is also responsible for the secretion of progesterone hormone.            

4 0
3 years ago
What triggers germination?
MrRissso [65]

Answer:

heyyyoo!!

Germination is the process of seeds developing into new plants. First, environmental conditions must trigger the seed to grow. Usually, this is determined by how deep the seed is planted, water availability, and temperature. The water activates special proteins, called enzymes, that begin the process of seed growth.

Explanation:

hope this helps >3

5 0
3 years ago
AQUATICS SCIENCE please help
zmey [24]

Answer:

hypotonic

Explanation:

5 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Fourier analysis is based on the finding that all sound waves _________. view available hint(s)
    10·1 answer
  • 16) During the winter time, the total number of hours of sunlight decreases. What effect would this have on the process of photo
    15·1 answer
  • What is one bioethical concern with using embryonic stem cells for regenerative medicine?
    10·2 answers
  • If carbon was the most common element found in the moons and planets, what element is missing that would make them similar to Ea
    10·2 answers
  • Which process return carbon to the atmosphere?
    8·1 answer
  • How does human evolution or natural selection relate to the susceptibility of disease
    8·1 answer
  • How could competition play a role in the way populations change?
    7·1 answer
  • Los árboles de manzano de zonas templadas no florecen naturalmente en el trópico. Un agrónomo hizo el siguiente experimento para
    7·2 answers
  • What is photosynthesis..?
    11·2 answers
  • It’s multiple-choice I just need the answers please
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!