<em>CORRECT STATEMENTS
> Water forms hydrogen bonds with other polar molecules. </em>
<em>> Water is a polar molecule. </em>
<em>> Water dissolves more ionic compounds.</em>
<em />Water is a polar molecule because of its uneven distribution of electron density. It is made up of two hydrogen atoms and one positive atom.
Since water is a polar molecule, it forms hydrogen bonds with other polar molecules. Though these bonds are relatively weak, however, there are so many of them present in water.
Water also dissolves most ionic compounds due to the fact that water is a universal solvent. When these compounds are added to water, there will be an interaction between the individual ions and the polar regions of the water molecules and disrupts the ionic bonds.
<em>INCORRECT </em>
> Liquid water is less dense than water vapor. - Liquid water has a higher density than water vapor. The fact that water vapor rises indicates that it is less dense than water.
>Water dissolves more hydrophobic substances. - Hydrophobic substances do not dissolve easily in water. It is termed as 'hydrophobic" because it means water-fearing.
Answer:
See answer below. Hope it helps.
Explanation:
This can have advantages and disadvantages. The artificially selected animals could have better traits than naturally selected animals, but in the long run, it will be harder for them to evolve and adapt to new environments because of the lack of variation in their traits.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
Non-disjunction of chromosomes.
Explanation:
2 sets of Chromosomes are supposed to be separated into each daughter gamete cells but non disjunction occurred that resulted in both sets of chromosomes being isolated into 1 gamete and the other having no chromosome
Answer:
I believe the answer is D
