Answer:
CAGUAGCUGCUAGCCUACGG
Explanation:
A and U are opposites
C and G are opposites
so you would do the opposite that would correspond.
Natural selection: organisms with certain inherited traits that are more likely to survive and reproduce than others.
These favorable traits can give an organism an advantage by giving them a higher chance of survival and reproduction. Darwin called this, "survival of the fittest"
Answer:
MOON PHASES: Moon phases are caused by observing the half-lit Moon at different times during its orbit of the Earth. All people on Earth see the same moon phase at the same time, though those in the southern hemisphere see the moon upside down compared with the northern. Solar eclipses are caused by the Moon coming exactly between the Earth and the Sun, blocking all but a small shadow of the Sun’s light to the Earth.
SEASONS: Seasons Interactive, Seasons Interactive An interactive that illustrates the relationships between the axial tilt of the Earth, latitude, and temperature. Several data sets (including temperature, Sun-Earth distance, daylight hours) can be generated.
Explanation:
Yw and pls mark me as the BRAINIEST (✿◡‿◡)
Gene mutations can be positive, negative, or neutral. Suppose that the normal gene in Model 2 produced a polypeptide that was necessary for cellular respiration.
A) Choose a mutation from those in Model 2 that might be positive for a cell. Explain your reasoning by relating the mutation to the cellular respiration process.
Genes encoded in our DNA result in the production of proteins that perform specific functions within human's cells and various environmental factors and spontaneous events can lead to changes in genes, these changes are called mutations, can lead to alterations in the structure and activity of the proteins in the cells use. Mutations are the source of all new alleles in nature and arise spontaneously at low frequency owing to the chemical instability of purine and pyrimidine bases and to errors during DNA replication. Therefore,a gene mutation is a change in the sequence of nucleotides that occurs during cell replication (mitosis and meiosis) within a single coding section of DNA. Variations in alleles lead to variations in organisms within a population, cellular respiration, i.e. the reduction of inspired oxygen to water, which powers cell function, also generates highly reactive oxygen species that can damage DNA, with the purine bases G and A being particularly susceptible to this kind of attack,so Positive mutations lead to the organism having a better chance of survival, which means the mutation may be passed on to the offspring.
B) Choose a mutation from those in Model 2 that might be negative for a cell. Explain your reasoning by relating the mutation to the cellular respiration process.
Due to one's metabolism, the human body replaces every cell within the cellular respiration process and any mistakes can also occur in the transcription of mRNA or the translation of a polypeptide. However, these changes are considered to be negative mutations, because they are not permanent changes to the cell, however such mutations may lead to an early death probably before the organism can produce offspring.
