1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
steposvetlana [31]
3 years ago
13

Please in need of help

Biology
2 answers:
konstantin123 [22]3 years ago
6 0

Answer:

c

Explanation:

i guess

Rzqust [24]3 years ago
5 0

Answer:

the answer is C i know it

Explanation:

i expect brainliest

You might be interested in
We can accurately determine the age of a rock or fossil by measuring its
Inga [223]

Answer:

the amount of carbon-13 it contains

Explanation:

carbon dating has been used many historians, scientists and researchers in order to correctly estimate the amount of carbon it contains. This is because all substances contai carbon and the levels of carbon decrease/deteriorate over time

8 0
3 years ago
What are the products of photosynthesis?<br>​
Softa [21]

Answer:

Sugar and Oxygen

Explanation:

Photosynthesis takes in carbon dioxide (CO₂), sunlight (energy), and water (H₂O) to produce C₆H12O₆ and O₂.

8 0
3 years ago
Translation takes place at ribosomes. What is produced during the process?
KIM [24]

Answer:

1) protein because ribosomes produce proteins and translation created short sequences of amino acids aka the building blocks of proteins

Explanation:

3 0
2 years ago
Read 2 more answers
Many evolutionists have performed experiments to try to produce living things from common chemicals. All of these experiments ha
dezoksy [38]

Answer:

abiogenesis

Explanation:

Abiogenesis is the idea that supports the thought that the emergence of life is associated with the non-living things. It is believed that initially, the structure of the formation of life was simple. With further process, it turned to be complex. According to this hypothesis, the non-living matter of the Earth gave birth to the living matter.  

In the given excerpt, the experiment performed by the evolutionists by using chemicals is an example of abiogenesis.

3 0
3 years ago
In human body temperature is kept fairly constant by automatic responses controlled by
Lady_Fox [76]

In human body temperature is kept fairly constant by automatic responses controlled by hypothalamus.  It secrete neurohormone , called as hypothalamic releasing hormone which stimulate and secrete  pituitary hormones. Hypothalamus is responsible for the control of body temperature.

7 0
3 years ago
Other questions:
  • Which cell organelle is flexible due to its arrangement of phospholipids
    10·1 answer
  • Which of the following could be discovered by studying the gross anatomy of a cadaver?
    15·1 answer
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • All of the following are stages of mitosis except: O Metaphase OG1 O Anaphase O Telophase O Prophase​
    14·1 answer
  • Select all of the questions that can be tested scientifically. Why is my brother so annoying? Why don’t pickles get moldy? What
    14·2 answers
  • During replication, the function of the enzyme DNA polymerase is to
    12·1 answer
  • 36. Mitosis requires the chromosome to be replicated into______ copies.<br> a. 2<br> b. 6<br> c. 1
    9·2 answers
  • I
    13·1 answer
  • Hey! real question for the women and girls,
    15·1 answer
  • What is the relationship between structure and function of biological molecules?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!