1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IRINA_888 [86]
3 years ago
14

Which statements describe evidence of continental drift? Check all that apply. Deserts lineup when continents are pushed togethe

r. Mountain ranges often appear on edges of continents. Fossils of the same animals appear on different continents. Tropical plants currently appear in both Antarctica in South America. What do you notice theories were excepted by most geologists in the 1960s. And explorers discovered the edges of continents they did not know about.
Biology
1 answer:
Zielflug [23.3K]3 years ago
4 0

Mountain ranges often appear on the edges of continents.

Fossils of the same animals appear on different continents.

Naetoosmart
2 years ago
(B) and (C)
You might be interested in
How can hybridization be used to produce plants with characteristics needed to increase food production
Setler79 [48]
<span>hybridization can be used to produce plants giving a high yield by breeding an indigenous variety of the plant having disease and pest resistant qualities and also a greater adaptability to the particular environment with a high yielding exotic variety to get an offspring having the desired qualities of both and also promoting hybrid </span>
3 0
4 years ago
Which of the following BEST represents competition among organisms?
Black_prince [1.1K]

Answer:

B

Explanation:

8 0
3 years ago
While looking at a cell under a microscope, a scientist is able to see a biological molecule. This molecule is a nucleic acid wi
Gnom [1K]
The nucleic acid is DNA 
8 0
3 years ago
Read 2 more answers
During which season does the rabbit population increase most rapidly
love history [14]
I’m pretty sure it’s winter because most mammals like to hibernate so I think the population is gonna increase lost rapidly in winter or march
8 0
3 years ago
A 17-year-old gravid client presents for a regularly scheduled 26-week prenatal visit. she appears disheveled, is wearing ill-fi
Afina-wow [57]
For the answer to the question above, <span>Blurred Vision

A severe headache, visual disturbances such as blurred vision and some epigastric pain that is associated with the development of severe pre-eclampsia or eclampsia. These danger signs and symptoms must be reported immediately as soon as possible. A severe headache and visual disturbances are related to severe vasoconstriction and in a severe increase in blood pressure. Epigastric pain is related to hepatic dysfunction. Ankle edema is a common thing during the third trimester of pregnancy. However, the facial edema is associated with increased fluid retention and the progression from mild to severe pre-eclampsia. Increased energy levels aren't associated with a progression of the client's pre-eclampsia or the development of the complications. In fact, some women are reporting an "energy spurt" before the onset of labor. A mild back-ache is just a common discomfort of pregnancy, unrelated to a progression of the client's pre-eclampsia. It also may be associated with bed rest when the mattress is not firm. Some multi-parous women have reported a mild backache as a sign of impending labor.</span>
8 0
3 years ago
Other questions:
  • When can primary succession occur?
    12·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the following is a from of pollution triggered by formation of a gas, and can have dramatic effects on the health of a
    5·1 answer
  • What is A mixture is
    9·2 answers
  • Your respiratory muscles contract each time you exhale.<br><br><br> TrueFalse
    5·1 answer
  • List, in order, the tRNA anticodons that are complementary to the mRNA sequence <br> AUGCAUGCAAGUUAG
    7·1 answer
  • Please PLEASEEEE PLEASEE HELP
    11·1 answer
  • Which muscles, when contracted unilaterally, will produce lateral bend of the spine?
    9·1 answer
  • How can having more producers benefit a ecosystem
    6·2 answers
  • Why may an asthmatic patient produce a wheezing sound and difficulty in breathing​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!